Advanced Search (OLGA)

Gene: LINC02869 (long intergenic non-protein coding RNA 2869) Homo sapiens

Subscribe to Updates

Analyze

Symbol:

LINC02869

Name:

long intergenic non-protein coding RNA 2869

RGD ID:

1625840

HGNC Page

HGNC:32045

Description:

ASSOCIATED WITH Usher syndrome; INTERACTS WITH sodium arsenite

Type:

ncrna (Ensembl: lncRNA)

RefSeq Status:

VALIDATED

Previously known as:

C1orf143; chromosome 1 open reading frame 143; chromosome 1 open reading frame 143 (putative)

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	218,510,095 - 218,525,978 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	1	218,459,265 - 218,525,986 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	1	218,683,437 - 218,699,320 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Cytogenetic Map	1	q41	NCBI
T2T-CHM13v2.0	1	217,744,816 - 217,760,704 (+)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
LINC02869	Human	Usher syndrome		IAGP	RGD:13435444	8554872	ClinVar Annotator: match by term: Usher syndrome	ClinVar	PMID:28041643

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
LINC02869	Human	sodium arsenite	decreases expression	EXP		6480464	sodium arsenite results in decreased expression of LINC02869 mRNA	CTD	PMID:34032870

PMID:11181995	PMID:11329013

Variants in LINC02869
24 total Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 1q41(chr1:217558925-218732002)x3	copy number gain	See cases [RCV000142313]	Chr1:217558925..218732002 [GRCh38] Chr1:217732267..218905344 [GRCh37] Chr1:215798890..216971967 [NCBI36] Chr1:1q41	uncertain significance
GRCh38/hg38 1q32.3-44(chr1:214023812-248918469)x3	copy number gain	See cases [RCV000050981]	Chr1:214023812..248918469 [GRCh38] Chr1:214197155..249212668 [GRCh37] Chr1:212263778..247179291 [NCBI36] Chr1:1q32.3-44	pathogenic
GRCh38/hg38 1q41(chr1:217452423-218818361)x1	copy number loss	See cases [RCV000053954]	Chr1:217452423..218818361 [GRCh38] Chr1:217625765..218991703 [GRCh37] Chr1:215692388..217058326 [NCBI36] Chr1:1q41	pathogenic
GRCh38/hg38 1q41(chr1:215206760-222004068)x1	copy number loss	See cases [RCV000050298]	Chr1:215206760..222004068 [GRCh38] Chr1:215380103..222177410 [GRCh37] Chr1:213446726..220244033 [NCBI36] Chr1:1q41	pathogenic
GRCh38/hg38 1q32.2-44(chr1:207346642-248930485)x3	copy number gain	See cases [RCV000143727]	Chr1:207346642..248930485 [GRCh38] Chr1:207519987..249224684 [GRCh37] Chr1:205586610..247191307 [NCBI36] Chr1:1q32.2-44	pathogenic
GRCh38/hg38 1q41(chr1:215447347-221971832)x3	copy number gain	See cases [RCV000051874]	Chr1:215447347..221971832 [GRCh38] Chr1:215620690..222145174 [GRCh37] Chr1:213687313..220211797 [NCBI36] Chr1:1q41	pathogenic
GRCh38/hg38 1q32.2-44(chr1:209646207-248931113)x3	copy number gain	See cases [RCV000051861]	Chr1:209646207..248931113 [GRCh38] Chr1:209819552..249225312 [GRCh37] Chr1:207886175..247191935 [NCBI36] Chr1:1q32.2-44	pathogenic
GRCh38/hg38 1q41(chr1:218520148-218603627)x3	copy number gain	See cases [RCV000134212]	Chr1:218520148..218603627 [GRCh38] Chr1:218693490..218776969 [GRCh37] Chr1:216760113..216843592 [NCBI36] Chr1:1q41	benign
GRCh38/hg38 1q41(chr1:218321722-218961624)x1	copy number loss	See cases [RCV000050854]	Chr1:218321722..218961624 [GRCh38] Chr1:218495064..219134966 [GRCh37] Chr1:216561687..217201589 [NCBI36] Chr1:1q41	uncertain significance
GRCh38/hg38 1q32.2-44(chr1:209963625-248918469)x3	copy number gain	See cases [RCV000134979]	Chr1:209963625..248918469 [GRCh38] Chr1:210136970..249212668 [GRCh37] Chr1:208203593..247179291 [NCBI36] Chr1:1q32.2-44	pathogenic
GRCh38/hg38 1q31.1-42.11(chr1:187143981-224299417)x3	copy number gain	See cases [RCV000051857]	Chr1:187143981..224299417 [GRCh38] Chr1:187113113..224487119 [GRCh37] Chr1:185379736..222553742 [NCBI36] Chr1:1q31.1-42.11	pathogenic
GRCh38/hg38 1q32.1-42.12(chr1:204764914-225408698)x3	copy number gain	See cases [RCV000142054]	Chr1:204764914..225408698 [GRCh38] Chr1:204734042..225596400 [GRCh37] Chr1:203000665..223663023 [NCBI36] Chr1:1q32.1-42.12	pathogenic
GRCh38/hg38 1q41(chr1:215206760-222004068)x1	copy number loss	See cases [RCV000148255]	Chr1:215206760..222004068 [GRCh38] Chr1:215380103..222177410 [GRCh37] Chr1:213446726..220244033 [NCBI36] Chr1:1q41	pathogenic
GRCh38/hg38 1q41(chr1:216518607-219827290)x1	copy number loss	See cases [RCV000053953]	Chr1:216518607..219827290 [GRCh38] Chr1:216691949..220000632 [GRCh37] Chr1:214758572..218067255 [NCBI36] Chr1:1q41	pathogenic
Single allele	deletion	Usher syndrome [RCV000505151]	Chr1:216066818..222607612 [GRCh38] Chr1:216240159..222780953 [GRCh37] Chr1:1q41	likely pathogenic
NC_000001.11:g.(?_218405159)_(219273649_?)del	deletion	Loeys-Dietz syndrome 4 [RCV001824378]	Chr1:218405159..219273649 [GRCh38] Chr1:218578501..219446991 [GRCh37] Chr1:1q41	likely pathogenic
GRCh38/hg38 1q32.2-42.13(chr1:228006998-228061271)x2	copy number loss	Orofacial cleft 2 [RCV002481175]	Chr1:228006998..228061271 [GRCh38] Chr1:1q32.2-42.13	association

Predicted Target Of

	Summary Value
Count of predictions:	235
Count of miRNA genes:	213
Interacting mature miRNAs:	219
Transcripts:	ENST00000443836, ENST00000491260
Prediction methods:	Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
597359515	GWAS1455589_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455589 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218513613	218513614	Human
597359513	GWAS1455587_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455587 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218517972	218517973	Human
597359518	GWAS1455592_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455592 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218517790	218517791	Human
597359519	GWAS1455593_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455593 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218517510	218517511	Human
597359517	GWAS1455591_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455591 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511508	218511509	Human
597378332	GWAS1474406_H	emphysema pattern measurement QTL GWAS1474406 (human)		3e-09	emphysema pattern measurement		1	218524685	218524686	Human
597362834	GWAS1458908_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1458908 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218521283	218521284	Human
597362832	GWAS1458906_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1458906 (human)		0.0000009	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218521705	218521706	Human
597359510	GWAS1455584_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455584 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218513401	218513402	Human
597362838	GWAS1458912_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1458912 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218520110	218520111	Human
597513619	GWAS1609693_H	FEV/FVC ratio QTL GWAS1609693 (human)		2e-09	FEV/FVC ratio	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218515813	218515814	Human
597363211	GWAS1459285_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459285 (human)		0.0000008	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218524640	218524641	Human
597363210	GWAS1459284_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459284 (human)		0.0000007	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218525386	218525387	Human
596975629	GWAS1095148_H	thyroid stimulating hormone measurement QTL GWAS1095148 (human)		2e-15	thyroid stimulating hormone measurement		1	218511713	218511714	Human
597392130	GWAS1488204_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1488204 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218521302	218521303	Human
597392129	GWAS1488203_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1488203 (human)		0.0000009	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218521649	218521650	Human
596962570	GWAS1082089_H	gastroesophageal reflux disease, vital capacity QTL GWAS1082089 (human)		9e-09	gastroesophageal reflux disease, vital capacity		1	218513520	218513521	Human
597363511	GWAS1459585_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459585 (human)		0.0000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218520470	218520471	Human
597363510	GWAS1459584_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459584 (human)		0.0000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218510342	218510343	Human
597363498	GWAS1459572_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459572 (human)		0.0000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218523561	218523562	Human
597372579	GWAS1468653_H	chronic obstructive pulmonary disease QTL GWAS1468653 (human)		4e-09	lung integrity trait (VT:0010906)		1	218515813	218515814	Human
597452960	GWAS1549034_H	gastroesophageal reflux disease, vital capacity QTL GWAS1549034 (human)		9e-09	gastroesophageal reflux disease, vital capacity		1	218513520	218513521	Human
597474464	GWAS1570538_H	diffusing capacity of the lung for carbon monoxide QTL GWAS1570538 (human)		9e-09	diffusing capacity of the lung for carbon monoxide		1	218515813	218515814	Human
597359524	GWAS1455598_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455598 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218516117	218516118	Human
597359525	GWAS1455599_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1455599 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218515944	218515945	Human
597400027	GWAS1496101_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496101 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218518160	218518161	Human
597400026	GWAS1496100_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496100 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218512653	218512654	Human
597378010	GWAS1474084_H	emphysema pattern measurement QTL GWAS1474084 (human)		3e-08	emphysema pattern measurement		1	218524685	218524686	Human
597400025	GWAS1496099_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496099 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511498	218511499	Human
597016534	GWAS1112608_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1112608 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218520349	218520350	Human
597400031	GWAS1496105_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496105 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218512377	218512378	Human
597401823	GWAS1497897_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1497897 (human)		8e-08	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218524685	218524686	Human
597400286	GWAS1496360_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496360 (human)		0.000003	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218510186	218510187	Human
597400030	GWAS1496104_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496104 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218515494	218515495	Human
597400029	GWAS1496103_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496103 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218516032	218516033	Human
597378013	GWAS1474087_H	emphysema pattern measurement QTL GWAS1474087 (human)		7e-09	emphysema pattern measurement		1	218524685	218524686	Human
597400028	GWAS1496102_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496102 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218514453	218514454	Human
597378012	GWAS1474086_H	emphysema pattern measurement QTL GWAS1474086 (human)		8e-09	emphysema pattern measurement		1	218524685	218524686	Human
597016542	GWAS1112616_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1112616 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511504	218511505	Human
597016539	GWAS1112613_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1112613 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218510194	218510195	Human
597388757	GWAS1484831_H	forced expiratory volume, response to bronchodilator QTL GWAS1484831 (human)		0.0000004	forced expiratory volume, response to bronchodilator	forced expiratory volume (CMO:0000254)	1	218523561	218523562	Human
597362506	GWAS1458580_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1458580 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218517235	218517236	Human
597363021	GWAS1459095_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1459095 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218510675	218510676	Human
597362508	GWAS1458582_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1458582 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511718	218511719	Human
597402432	GWAS1498506_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1498506 (human)		0.0000003	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511890	218511891	Human
597016526	GWAS1112600_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1112600 (human)		0.000001	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511946	218511947	Human
597363012	GWAS1459086_H	FEV/FVC ratio QTL GWAS1459086 (human)		0.000005	FEV/FVC ratio	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218515813	218515814	Human
597467000	GWAS1563074_H	forced expiratory volume, response to bronchodilator QTL GWAS1563074 (human)		0.0000009	forced expiratory volume, response to bronchodilator	forced expiratory volume (CMO:0000254)	1	218510342	218510343	Human
597466999	GWAS1563073_H	forced expiratory volume, response to bronchodilator QTL GWAS1563073 (human)		0.000001	thyroid stimulating hormone measurement		1	218520470	218520471	Human
597402728	GWAS1498802_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1498802 (human)		9e-08	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218515813	218515814	Human
597400034	GWAS1496108_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496108 (human)		0.000002	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218511789	218511790	Human
597400288	GWAS1496362_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1496362 (human)		0.000004	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218512033	218512034	Human
597401824	GWAS1497898_H	FEV/FVC ratio, response to bronchodilator QTL GWAS1497898 (human)		9e-08	FEV/FVC ratio, response to bronchodilator	forced expiratory volume to forced vital capacity ratio (CMO:0000241)	1	218517606	218517607	Human

D1S1423

Human Assembly	Chr	Position (strand)	Source
Cytogenetic Map	10	p12.1	UniSTS
Cytogenetic Map	10	p12.1-p11.2	UniSTS
Cytogenetic Map	9	q34.13	UniSTS
Cytogenetic Map	16	q22.1	UniSTS
Cytogenetic Map	21	q22.2	UniSTS
Cytogenetic Map	3	p24.2	UniSTS
Cytogenetic Map	9	q32	UniSTS
Cytogenetic Map	1	q24	UniSTS
Cytogenetic Map	1	q21	UniSTS
Cytogenetic Map	1	p36.33	UniSTS
Cytogenetic Map	7	p15.2	UniSTS
Cytogenetic Map	6	p21	UniSTS
Cytogenetic Map	5	q31	UniSTS
Cytogenetic Map	6	p22.3-p21.32	UniSTS
Cytogenetic Map	6	q22.33	UniSTS
Cytogenetic Map	3	q29	UniSTS
Cytogenetic Map	17	p11.2	UniSTS
Cytogenetic Map	19	q13.3	UniSTS
Cytogenetic Map	1	p36.13	UniSTS
Cytogenetic Map	5	q33.3	UniSTS
Cytogenetic Map	22	q11.22	UniSTS
Cytogenetic Map	11	q13.2-q13.3	UniSTS
Cytogenetic Map	3	q22-q24	UniSTS
Cytogenetic Map	8	p21.3	UniSTS
Cytogenetic Map	7	q32	UniSTS
Cytogenetic Map	1	p32.3	UniSTS
Cytogenetic Map	19	p13.12	UniSTS
Cytogenetic Map	4	q21.1	UniSTS
Cytogenetic Map	12	q13.13	UniSTS
Cytogenetic Map	7	q11.2	UniSTS
Cytogenetic Map	1	p22.1	UniSTS
Cytogenetic Map	2	q32	UniSTS
Cytogenetic Map	X	q13.1	UniSTS
Cytogenetic Map	9	q12	UniSTS
Cytogenetic Map	3	q26.2	UniSTS
Cytogenetic Map	22	q11.21	UniSTS
Cytogenetic Map	10	q23-q24	UniSTS
Cytogenetic Map	17	q12	UniSTS
Cytogenetic Map	1	p36.21	UniSTS
Cytogenetic Map	19	p13.2	UniSTS
Cytogenetic Map	16	q24.3	UniSTS
Cytogenetic Map	9	q34.3	UniSTS
Cytogenetic Map	4	p14	UniSTS
Cytogenetic Map	2	p12	UniSTS
Cytogenetic Map	16	p11.2	UniSTS
Cytogenetic Map	3	q23	UniSTS
Cytogenetic Map	18	q22.1	UniSTS
Cytogenetic Map	13	q12	UniSTS
Cytogenetic Map	10	p14-p13	UniSTS
Cytogenetic Map	12	p13.31	UniSTS
Cytogenetic Map	14	q24.3	UniSTS
Cytogenetic Map	22	q13.2	UniSTS
Cytogenetic Map	19	q13.11	UniSTS
Cytogenetic Map	11	q23-q24	UniSTS
Cytogenetic Map	11	q13.1	UniSTS
Cytogenetic Map	12	q24.31	UniSTS
Cytogenetic Map	17	q25	UniSTS
Cytogenetic Map	16	q24.1	UniSTS
Cytogenetic Map	5	q23.3	UniSTS
Cytogenetic Map	19	q13.43	UniSTS
Cytogenetic Map	17	q11.2	UniSTS
Cytogenetic Map	20	q13.12	UniSTS
Cytogenetic Map	X	p11.23	UniSTS
Cytogenetic Map	19	q13.42	UniSTS
Cytogenetic Map	16	q13	UniSTS
Cytogenetic Map	11	q25	UniSTS
Cytogenetic Map	22	cen-q12.3	UniSTS
Cytogenetic Map	10	p13	UniSTS
Cytogenetic Map	2	p11.2	UniSTS
Cytogenetic Map	15	q11.2-q21.3	UniSTS
Cytogenetic Map	1	p21.2	UniSTS
Cytogenetic Map	19	p13	UniSTS
Cytogenetic Map	7	q21.13	UniSTS
Cytogenetic Map	7	q31.1	UniSTS
Cytogenetic Map	17	p13.3	UniSTS
Cytogenetic Map	1	p35.1	UniSTS
Cytogenetic Map	16	q24	UniSTS
Cytogenetic Map	3	q25	UniSTS
Cytogenetic Map	2	q24.2	UniSTS
Cytogenetic Map	1	p31.3	UniSTS
Cytogenetic Map	14	q31.1	UniSTS
Cytogenetic Map	22	q13.1	UniSTS
Cytogenetic Map	20	q13.31	UniSTS
Cytogenetic Map	19	p13.3	UniSTS
Cytogenetic Map	6	p12.1	UniSTS
Cytogenetic Map	6	q25.3	UniSTS
Cytogenetic Map	1	q32.1	UniSTS
Cytogenetic Map	11	q24.2	UniSTS
Cytogenetic Map	10	p15.1	UniSTS
Cytogenetic Map	2	p13.1	UniSTS
Cytogenetic Map	19	q13.12	UniSTS
Cytogenetic Map	12	p13.32	UniSTS
Cytogenetic Map	4	q35.1	UniSTS
Cytogenetic Map	2	p13.3	UniSTS
Cytogenetic Map	1	p22	UniSTS
Cytogenetic Map	2	q14	UniSTS
Cytogenetic Map	4	q12	UniSTS
Cytogenetic Map	16	p13.3	UniSTS
Cytogenetic Map	14	q32.33	UniSTS
Cytogenetic Map	1	p36.1	UniSTS
Cytogenetic Map	8	p11.21	UniSTS
Cytogenetic Map	X	q26.3	UniSTS
Cytogenetic Map	8	q24.11	UniSTS
Cytogenetic Map	9	q22.31	UniSTS
Cytogenetic Map	7	q11.23	UniSTS
Cytogenetic Map	2	p15	UniSTS
Cytogenetic Map	5	q31.1	UniSTS
Cytogenetic Map	8	q24.13	UniSTS
Cytogenetic Map	17	p13	UniSTS
Cytogenetic Map	8	p11.22	UniSTS
Cytogenetic Map	4	q28	UniSTS
Cytogenetic Map	15	q24.1	UniSTS
Cytogenetic Map	1	q41-q42	UniSTS
Cytogenetic Map	10	q22	UniSTS
Cytogenetic Map	5	q35.3	UniSTS
Cytogenetic Map	20	q11.21	UniSTS
Cytogenetic Map	8	q24.3	UniSTS
Cytogenetic Map	12	p13.1-p12.3	UniSTS
Cytogenetic Map	6	p21.33	UniSTS
Cytogenetic Map	22	q13.33	UniSTS
Cytogenetic Map	19	p12	UniSTS
Cytogenetic Map	1	p13.1	UniSTS
Cytogenetic Map	7	q22.1	UniSTS
Cytogenetic Map	14	q12	UniSTS
Cytogenetic Map	19	q13.32	UniSTS
Cytogenetic Map	11	q13.2	UniSTS
Cytogenetic Map	15	q22.31	UniSTS
Cytogenetic Map	5	q12.3	UniSTS
Cytogenetic Map	7	q33	UniSTS
Cytogenetic Map	17	q21.2	UniSTS
Cytogenetic Map	4	q23	UniSTS
Cytogenetic Map	12	q13.12	UniSTS
Cytogenetic Map	18	p11.21	UniSTS
Cytogenetic Map	10	q26.11	UniSTS
Cytogenetic Map	14	q32.12	UniSTS
Cytogenetic Map	11	q24.1	UniSTS
Cytogenetic Map	18	q23	UniSTS
Cytogenetic Map	2	q31.1	UniSTS
Cytogenetic Map	18	p11.31	UniSTS
Cytogenetic Map	2	q24.3	UniSTS
Cytogenetic Map	11	q23	UniSTS
Cytogenetic Map	17	q21.31	UniSTS
Cytogenetic Map	13	q34	UniSTS
Cytogenetic Map	1	p34.3	UniSTS
Cytogenetic Map	10	p14	UniSTS
Cytogenetic Map	15	q22.2	UniSTS
Cytogenetic Map	17	q25.1	UniSTS
Cytogenetic Map	5	q32	UniSTS
Cytogenetic Map	4	p16.3	UniSTS
Cytogenetic Map	12	q23.2	UniSTS
Cytogenetic Map	11	q12.3	UniSTS
Cytogenetic Map	16	q12.2	UniSTS
Cytogenetic Map	9	q22.2	UniSTS
Cytogenetic Map	1	q21.3	UniSTS
Cytogenetic Map	1	p35.3	UniSTS
Cytogenetic Map	19	q13.2	UniSTS
Cytogenetic Map	11	p15.5	UniSTS
Cytogenetic Map	7	q22	UniSTS
Cytogenetic Map	18	p11.31-p11.21	UniSTS
Cytogenetic Map	3	p25.3	UniSTS
Cytogenetic Map	3	q13	UniSTS
Cytogenetic Map	21	q22.3	UniSTS
Cytogenetic Map	1	q43	UniSTS
Cytogenetic Map	19	p13.11	UniSTS
Cytogenetic Map	19	q13.41	UniSTS
Cytogenetic Map	7	p21.2	UniSTS
Cytogenetic Map	12	q21.1	UniSTS
Cytogenetic Map	15	q15.1	UniSTS
Cytogenetic Map	15	q13.1	UniSTS
Cytogenetic Map	1	q42.1	UniSTS
Cytogenetic Map	5	q31.2	UniSTS
Cytogenetic Map	1	q21.2	UniSTS
Cytogenetic Map	17	p13.1	UniSTS
Cytogenetic Map	1	p34-p33	UniSTS
Cytogenetic Map	3	q22.1	UniSTS
Cytogenetic Map	7	p14	UniSTS
Cytogenetic Map	15	q21	UniSTS
Cytogenetic Map	12	q24.2	UniSTS
Cytogenetic Map	20	q13	UniSTS
Cytogenetic Map	19	q13.3-q13.4	UniSTS
Cytogenetic Map	17	q21.32	UniSTS
Cytogenetic Map	15	q11.2	UniSTS
Cytogenetic Map	8	p23-p22	UniSTS
Cytogenetic Map	1	p12	UniSTS
Cytogenetic Map	3	q13.33	UniSTS
Cytogenetic Map	10	p12.33	UniSTS
Cytogenetic Map	5	q13.2	UniSTS
Cytogenetic Map	3	q26	UniSTS
Cytogenetic Map	9	p21.2	UniSTS
Cytogenetic Map	2	p16.1	UniSTS
Cytogenetic Map	5	q21.3	UniSTS
Cytogenetic Map	1	p36.22	UniSTS
Cytogenetic Map	1	p34.2	UniSTS
Cytogenetic Map	3	q26.31	UniSTS
Cytogenetic Map	X	p22.33	UniSTS
Cytogenetic Map	Y	p11.3	UniSTS
Cytogenetic Map	17	q24.1	UniSTS
Cytogenetic Map	9	q21.11	UniSTS
Cytogenetic Map	6	q22.31	UniSTS
Cytogenetic Map	9	q21.13	UniSTS
Cytogenetic Map	10	q11.22	UniSTS
Cytogenetic Map	22	q13.31	UniSTS
Cytogenetic Map	17	p12	UniSTS
Cytogenetic Map	17	q21.33	UniSTS
Cytogenetic Map	5	p13.3	UniSTS
Cytogenetic Map	10	q21.3	UniSTS
Cytogenetic Map	10	q22.1	UniSTS
Cytogenetic Map	1	p34	UniSTS
Cytogenetic Map	X	p22	UniSTS
Cytogenetic Map	20	p12.3-p11.21	UniSTS
Cytogenetic Map	2	q37.1	UniSTS
Cytogenetic Map	6	p25	UniSTS
Cytogenetic Map	X	q27.2	UniSTS
Cytogenetic Map	4	q31.1	UniSTS
Cytogenetic Map	4	q31	UniSTS
Cytogenetic Map	22	q13.1-q13.2	UniSTS
Cytogenetic Map	X	q28	UniSTS
Cytogenetic Map	1	p36.11	UniSTS
Cytogenetic Map	12	q13.3	UniSTS
Cytogenetic Map	3	q26.33	UniSTS
Cytogenetic Map	19	q13.4	UniSTS
Cytogenetic Map	14	q32	UniSTS
Cytogenetic Map	10	q24.3	UniSTS
Cytogenetic Map	16	q21	UniSTS
Cytogenetic Map	2	p13	UniSTS
Cytogenetic Map	19	q13.1	UniSTS
Cytogenetic Map	7	q21-q22	UniSTS
Cytogenetic Map	2	q11.2	UniSTS
Cytogenetic Map	17	q25.3	UniSTS
Cytogenetic Map	4	q22.1	UniSTS
Cytogenetic Map	11	q22.1	UniSTS
Cytogenetic Map	12	q14.2	UniSTS
Cytogenetic Map	20	p13	UniSTS
Cytogenetic Map	7	q36.3	UniSTS
Cytogenetic Map	20	q11.21-q11.23	UniSTS
Cytogenetic Map	2	q33.2	UniSTS
Cytogenetic Map	12	q22	UniSTS
Cytogenetic Map	20	q13.13	UniSTS
Cytogenetic Map	21	p11.1	UniSTS
Cytogenetic Map	1	p35-p34.3	UniSTS
Cytogenetic Map	7	p11.2	UniSTS
Cytogenetic Map	13	q14	UniSTS
Cytogenetic Map	7	q36.1	UniSTS
Cytogenetic Map	12	q24.31-q24.32	UniSTS
Cytogenetic Map	17	q21.1	UniSTS
Cytogenetic Map	3	q12.3	UniSTS
Cytogenetic Map	12	q	UniSTS
Cytogenetic Map	11	q13.5	UniSTS
Cytogenetic Map	2	p14	UniSTS
Cytogenetic Map	2	q14.3	UniSTS
Cytogenetic Map	7	q34	UniSTS
Cytogenetic Map	14	q32.1	UniSTS
Cytogenetic Map	21	q22.11	UniSTS
Cytogenetic Map	3	p14.1	UniSTS
Cytogenetic Map	16	q23.2	UniSTS
Cytogenetic Map	7	q32.1	UniSTS
Cytogenetic Map	17	q22	UniSTS
Cytogenetic Map	4	q31.23	UniSTS
Cytogenetic Map	11	p15.3	UniSTS
Cytogenetic Map	3	q27.1	UniSTS
Cytogenetic Map	2	p22.3	UniSTS
Cytogenetic Map	22	q13	UniSTS
Cytogenetic Map	1	q32	UniSTS
Cytogenetic Map	11	q14	UniSTS
Cytogenetic Map	X	q13.2	UniSTS
Cytogenetic Map	16	p13.12	UniSTS
Cytogenetic Map	X	q22.3	UniSTS
Cytogenetic Map	9	p12	UniSTS
Cytogenetic Map	4	p16.1	UniSTS
Cytogenetic Map	11	q23.1	UniSTS
Cytogenetic Map	3	q27.3	UniSTS
Cytogenetic Map	16	q23.1	UniSTS
Cytogenetic Map	15	q15.2	UniSTS
Cytogenetic Map	2	p21	UniSTS
Cytogenetic Map	13	q33.3	UniSTS
Cytogenetic Map	15	q22-q24	UniSTS
Cytogenetic Map	14	q32.11	UniSTS
Cytogenetic Map	7	p14.3	UniSTS
Cytogenetic Map	14	q21.2	UniSTS
Cytogenetic Map	15	q25.2	UniSTS
Cytogenetic Map	15	q23	UniSTS
Cytogenetic Map	2	p23.3	UniSTS
Cytogenetic Map	4	p15.31	UniSTS
Cytogenetic Map	1	q22	UniSTS
Cytogenetic Map	20	q13.1	UniSTS
Cytogenetic Map	15	q21.3	UniSTS
Cytogenetic Map	10	q23.33	UniSTS
Cytogenetic Map	4	q26	UniSTS
Cytogenetic Map	X	q24	UniSTS
Cytogenetic Map	10	q23.1	UniSTS
Cytogenetic Map	6	p21.1	UniSTS
Cytogenetic Map	15	q22.1-q22.31	UniSTS
Cytogenetic Map	1	q31-q41	UniSTS
Cytogenetic Map	6	q23.3	UniSTS
Cytogenetic Map	7	q21.2	UniSTS
Cytogenetic Map	14	q23	UniSTS
Cytogenetic Map	12	q11-q12	UniSTS
Cytogenetic Map	17	q23.3	UniSTS
Cytogenetic Map	4	q24	UniSTS
Cytogenetic Map	1	p32	UniSTS
Cytogenetic Map	3	p21.1-p14.2	UniSTS
Cytogenetic Map	12	q22-q23.1	UniSTS
Cytogenetic Map	6	p22.1	UniSTS
Cytogenetic Map	6	q24.2	UniSTS
Cytogenetic Map	9	p13.3	UniSTS
Cytogenetic Map	6	p24.1	UniSTS
Cytogenetic Map	19	q13	UniSTS
Cytogenetic Map	20	q11.22-q11.23	UniSTS
Cytogenetic Map	3	p22.3	UniSTS
Cytogenetic Map	12	q12	UniSTS
Cytogenetic Map	X	q13-q21	UniSTS
Cytogenetic Map	9	q34.11	UniSTS
Cytogenetic Map	16	p13.13	UniSTS
Cytogenetic Map	10	pter-q25.3	UniSTS
Cytogenetic Map	9	p24.1	UniSTS
Cytogenetic Map	12	p13.2	UniSTS
Cytogenetic Map	12	q24	UniSTS
Cytogenetic Map	3	q28-q29	UniSTS
Cytogenetic Map	10	q26	UniSTS
Cytogenetic Map	6	p22.2	UniSTS
Cytogenetic Map	2	q13	UniSTS
Cytogenetic Map	12	q24.2-q24.31	UniSTS
Cytogenetic Map	22	q12.2	UniSTS
Cytogenetic Map	1	q32.2-q41	UniSTS
Cytogenetic Map	11	q22-q23	UniSTS
Cytogenetic Map	12	p13.3	UniSTS
Cytogenetic Map	1	p34.1	UniSTS
Cytogenetic Map	22	q11	UniSTS
Cytogenetic Map	2	q21.1	UniSTS
Cytogenetic Map	16	p13.11	UniSTS
Cytogenetic Map	1	q25.1	UniSTS
Cytogenetic Map	1	p36.3	UniSTS
Cytogenetic Map	9	p21	UniSTS
Cytogenetic Map	6	p21.3	UniSTS
Cytogenetic Map	1	q41	UniSTS
Cytogenetic Map	11	q13.1-q13.3	UniSTS
Cytogenetic Map	16	p13	UniSTS
Cytogenetic Map	15	q26	UniSTS
Cytogenetic Map	18	q21	UniSTS
Cytogenetic Map	4	p15.1-p14	UniSTS
Cytogenetic Map	8	q11.2	UniSTS
Cytogenetic Map	16	q22	UniSTS
Cytogenetic Map	15	q11-q13	UniSTS
Cytogenetic Map	7	p12.3	UniSTS
Cytogenetic Map	7	p13	UniSTS
Cytogenetic Map	15	q26.1	UniSTS
Cytogenetic Map	14	q22.1	UniSTS
Cytogenetic Map	2	q12.3	UniSTS
Cytogenetic Map	X	p22.12	UniSTS
Cytogenetic Map	20	q11.23	UniSTS
Cytogenetic Map	1	q21.1	UniSTS
Cytogenetic Map	1	p36.31	UniSTS
Cytogenetic Map	16	q11.2	UniSTS
Cytogenetic Map	14	q32.2	UniSTS
Cytogenetic Map	11	p15.4	UniSTS
Cytogenetic Map	22	q11.1	UniSTS
Cytogenetic Map	5	q33.2	UniSTS
Cytogenetic Map	14	q23.1	UniSTS
Cytogenetic Map	7	q32.3	UniSTS
Cytogenetic Map	20	q13.3	UniSTS
Cytogenetic Map	10	q26.13	UniSTS
Cytogenetic Map	1	p31.1	UniSTS
Cytogenetic Map	11	q13.4	UniSTS
Cytogenetic Map	11	q23.3	UniSTS
Cytogenetic Map	15	q25.1	UniSTS
Cytogenetic Map	9	p13	UniSTS
Cytogenetic Map	2	p24.2	UniSTS
Cytogenetic Map	9	q33.3	UniSTS
Cytogenetic Map	19	q13.31	UniSTS
Cytogenetic Map	11	q12.2	UniSTS
Cytogenetic Map	7	p15.3	UniSTS
Cytogenetic Map	6	p25.2	UniSTS
Cytogenetic Map	6	q25.1	UniSTS
Cytogenetic Map	3	p21.31	UniSTS
Cytogenetic Map	17	q23.2	UniSTS
Cytogenetic Map	X	q25	UniSTS
Cytogenetic Map	2	p25.1	UniSTS
Cytogenetic Map	1	q25.3	UniSTS
Cytogenetic Map	6	p24-p22.3	UniSTS
Cytogenetic Map	6	q21	UniSTS
Cytogenetic Map	16	p12.2	UniSTS
Cytogenetic Map	3	q21-q24	UniSTS
Cytogenetic Map	4	q13	UniSTS
Cytogenetic Map	11	p13	UniSTS
Cytogenetic Map	9	q34	UniSTS
Cytogenetic Map	8	q13.1	UniSTS
Cytogenetic Map	5	q21.2	UniSTS
Cytogenetic Map	4	q34.3	UniSTS
Cytogenetic Map	3	p22.1	UniSTS
Cytogenetic Map	2	q37.3	UniSTS
Cytogenetic Map	8	p23.1	UniSTS
Cytogenetic Map	1	p13.3	UniSTS
Cytogenetic Map	15	q14	UniSTS
Cytogenetic Map	13	q13.3	UniSTS
Cytogenetic Map	12	q13.2	UniSTS
Cytogenetic Map	1	q31	UniSTS
Cytogenetic Map	7	q11.21	UniSTS
Cytogenetic Map	10	q26.3	UniSTS
Cytogenetic Map	15	q15	UniSTS
Cytogenetic Map	X	p11.4	UniSTS
Cytogenetic Map	8	q24.12	UniSTS
Cytogenetic Map	15	q22	UniSTS
Cytogenetic Map	1	q25.2	UniSTS
Cytogenetic Map	13	q11-q12	UniSTS
Cytogenetic Map	10	q24.2	UniSTS
Cytogenetic Map	15	q21.1	UniSTS
Cytogenetic Map	15	q13.2	UniSTS
Cytogenetic Map	6	q25.2	UniSTS
Cytogenetic Map	14	q11.2	UniSTS
Cytogenetic Map	2	q33.1	UniSTS
Cytogenetic Map	6	q14.1	UniSTS
Cytogenetic Map	3	q23-q24	UniSTS
Cytogenetic Map	2	p25.1-p24.1	UniSTS
Cytogenetic Map	12	q14.3	UniSTS
Cytogenetic Map	6	q16.1	UniSTS
Cytogenetic Map	5	p13.1	UniSTS
Cytogenetic Map	5	q13	UniSTS
Cytogenetic Map	20	pter-p12	UniSTS
Cytogenetic Map	X	p22.11	UniSTS
Cytogenetic Map	16	p13.2	UniSTS
Cytogenetic Map	16	q22.3	UniSTS
Cytogenetic Map	7	q31.3	UniSTS
Cytogenetic Map	21	q22.13	UniSTS
Cytogenetic Map	1	p21	UniSTS
Cytogenetic Map	8	p11	UniSTS
Cytogenetic Map	7	p14.2	UniSTS
Cytogenetic Map	8	p11.23	UniSTS
Cytogenetic Map	18	p11.22	UniSTS
Cytogenetic Map	18	q21.33	UniSTS
Cytogenetic Map	9	p24.3	UniSTS
Cytogenetic Map	11	q22.3	UniSTS
Cytogenetic Map	14	q22.2	UniSTS
Cytogenetic Map	20	p11.22-p11.1	UniSTS
Cytogenetic Map	6	p21.31	UniSTS
Cytogenetic Map	14	q22.3	UniSTS
Cytogenetic Map	12	q15	UniSTS
Cytogenetic Map	7	q31	UniSTS
Cytogenetic Map	2	q12.2	UniSTS
Cytogenetic Map	8	p12	UniSTS
Cytogenetic Map	7	p22.1	UniSTS
Cytogenetic Map	6	p12.3	UniSTS
Cytogenetic Map	11	q12-q13	UniSTS
Cytogenetic Map	18	q21.1	UniSTS
Cytogenetic Map	10	p11.21	UniSTS
Cytogenetic Map	6	p22-p21	UniSTS
Cytogenetic Map	17	q21.1-q21.3	UniSTS
Cytogenetic Map	12	q24.33	UniSTS
Cytogenetic Map	4	p15.32	UniSTS
Cytogenetic Map	1	q42.13	UniSTS
Cytogenetic Map	19	q12	UniSTS
Cytogenetic Map	3	p14.3	UniSTS
Cytogenetic Map	12	p13.2-p12.3	UniSTS
Cytogenetic Map	9	q22.32	UniSTS
Cytogenetic Map	1	p36.3-p36.2	UniSTS
Cytogenetic Map	5	q22.2	UniSTS
Cytogenetic Map	4	p15.2	UniSTS
Cytogenetic Map	4	p15.3	UniSTS
Cytogenetic Map	4	q28.1	UniSTS
Cytogenetic Map	12	q13.1-q13.2	UniSTS
Cytogenetic Map	19	q13.33	UniSTS
Cytogenetic Map	1	p31	UniSTS
Cytogenetic Map	17	p13.2	UniSTS
Cytogenetic Map	15	q15.3	UniSTS
Cytogenetic Map	13	q14.11	UniSTS
Cytogenetic Map	9	p22.3	UniSTS
Cytogenetic Map	8	q22.2	UniSTS
Cytogenetic Map	8	q21.11	UniSTS
Cytogenetic Map	22	q12.1	UniSTS
Cytogenetic Map	3	q13.2	UniSTS
Cytogenetic Map	2	q35	UniSTS
Cytogenetic Map	2	q33.3	UniSTS
Cytogenetic Map	8	p22	UniSTS
Cytogenetic Map	10	q22.2	UniSTS
Cytogenetic Map	20	p12.1	UniSTS
Cytogenetic Map	6	q13	UniSTS
Cytogenetic Map	6	q22.32	UniSTS
Cytogenetic Map	5	q34	UniSTS
Cytogenetic Map	5	p15.2	UniSTS
Cytogenetic Map	5	q11.2	UniSTS
Cytogenetic Map	2	q36.1	UniSTS
Cytogenetic Map	18	q11.2	UniSTS
Cytogenetic Map	18	q12.2	UniSTS
Cytogenetic Map	14	q21.3	UniSTS
Cytogenetic Map	13	q33.1	UniSTS
Cytogenetic Map	12	p11.21	UniSTS
Cytogenetic Map	12	q23.1	UniSTS
Cytogenetic Map	16	p12.1	UniSTS
Cytogenetic Map	2	q33	UniSTS
Cytogenetic Map	5	q12.1	UniSTS
Cytogenetic Map	12	q24.13	UniSTS
Cytogenetic Map	13	q14.2	UniSTS
Cytogenetic Map	7	q36	UniSTS
Cytogenetic Map	10	q22.3-q23.2	UniSTS
Cytogenetic Map	7	p15	UniSTS
Cytogenetic Map	14	q32.31	UniSTS
Cytogenetic Map	11	q21	UniSTS
Cytogenetic Map	4	q21.3	UniSTS
Cytogenetic Map	7	p13-p12	UniSTS
Cytogenetic Map	8	p21.2	UniSTS
Cytogenetic Map	4	q22	UniSTS
Cytogenetic Map	11	q13	UniSTS
Cytogenetic Map	3	q12.1	UniSTS
Cytogenetic Map	7	q21.1-q22	UniSTS
Cytogenetic Map	17	q21	UniSTS
Cytogenetic Map	3	q13.13-q13.2	UniSTS
Cytogenetic Map	3	p21.3	UniSTS
Cytogenetic Map	13	q32.2	UniSTS
Cytogenetic Map	3	q26.32	UniSTS
Cytogenetic Map	15	q	UniSTS
Cytogenetic Map	2	p13.2	UniSTS
Cytogenetic Map	3	p12.3	UniSTS
Cytogenetic Map	10	q11.23	UniSTS
Cytogenetic Map	3	q11.2	UniSTS
Cytogenetic Map	12	q13.11	UniSTS
Cytogenetic Map	13	q14.13	UniSTS
Cytogenetic Map	10	q23	UniSTS
Cytogenetic Map	11	p11.2	UniSTS
Cytogenetic Map	6	q16.2	UniSTS
Cytogenetic Map	3	q21.1	UniSTS
Cytogenetic Map	10	q11.21	UniSTS
Cytogenetic Map	1	p13.2	UniSTS
Cytogenetic Map	6	p24.2	UniSTS
Cytogenetic Map	20	q13.33	UniSTS

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

adipose tissue	alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	entire extraembryonic component	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system
154	417	369	391	2496	590	1001	3	165	486	89	434	1620	1209	48	2185	350	748	850	86


RefSeq Transcripts	NR_146760	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC092015	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AI148415	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BG219097	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BX090916	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH471100	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068277	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENST00000443836

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,463,432 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000491260

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,524,633 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000663551

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,459,265 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000668967

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,709 - 218,525,986 (+)	Ensembl

Ensembl Acc Id:

ENST00000746055

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,463,432 - 218,525,982 (+)	Ensembl

Ensembl Acc Id:

ENST00000746056

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,463,477 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746057

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,485,416 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746058

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,485,422 - 218,525,975 (+)	Ensembl

Ensembl Acc Id:

ENST00000746059

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,729 - 218,525,979 (+)	Ensembl

Ensembl Acc Id:

ENST00000746060

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,812 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746061

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,812 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746062

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,813 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746063

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,812 - 218,525,975 (+)	Ensembl

Ensembl Acc Id:

ENST00000746064

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,816 - 218,525,978 (+)	Ensembl

Ensembl Acc Id:

ENST00000746065

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,494,816 - 218,525,757 (+)	Ensembl

Ensembl Acc Id:

ENST00000746066

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	218,519,462 - 218,525,978 (+)	Ensembl

RefSeq Acc Id:

NR_146760

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	1	218,510,095 - 218,525,978 (+)	NCBI
T2T-CHM13v2.0	1	217,744,816 - 217,760,704 (+)	NCBI

Sequence:

show sequence

GGGGTCATATCAGAAAGATATGTTTGATGAAATTAACTACAGAATCAAGAAGTATATACTCAAAAATGCAAATACTACAATATATAAGACAATGCTGGAGTGCAATGGTGCAATCTTGGCTCACTGCA
ACCTCCGCCTCCTGGGTTCAAATGATTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGACCGCAACCAATTGCTCTTCCTTCCCATTGAAAGAAACCCAGGCTGTACCTGCTCTTTCATCTCC
TGTGTGGAAAACATCTATCGGCTGGAAGCCCTGAGTCTTCATTTTCAAGGATTTTAGTTGTAAGCTGTTTAAGGCATAAGCTAAAGTTTCAGGCAGAGGTAATTTTAGTAGTTAAGCCTGATTTTTAC
TTCCACCCTCTGTCCTCCAGGGCTATATGGGAAGCTTTCTGTGAGTGGATAAGCTCTTTAGCTAAGATGTAAACATGTTCCCTGCTATCTGATAAAGGTTCCTGGAGACTGACACTTTAAAAAAAAAA
AAAAAAAGAAAGTGAGGAAAAAAAGAAAAGGAGAAACTGAATCCAAGGCTTACAAAGGGATTAGAAAACTGTACCCCAGATGGAAAATTTTATGGGCTCTGGAGAAAATGTGTAAGTGAAATATCGGT
ATCATAAAATAACAGGAAATAGTGTAATCTACCTGATGGAGAAAATTGTCACTTTAAAAAAACTATCCTAATTTCCTTCAAAATTGTTCTTGTTTTTGAGCCAATAAACTTCAGCTAAGCTCAAAAAA
AAAAAAAAAA

hide sequence


GenBank Protein	EAW93325	(Get FASTA)	NCBI Sequence Viewer

Database	Acc Id	Source(s)
COSMIC	LINC02869	COSMIC
Ensembl Genes	ENSG00000228208	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000443836	ENTREZGENE
GTEx	ENSG00000228208	GTEx
HGNC ID	HGNC:32045	ENTREZGENE
Human Proteome Map	LINC02869	Human Proteome Map
NCBI Gene	440714	ENTREZGENE
RNAcentral	URS000076282C	RNACentral
	URS0000776C02	RNACentral
	URS0000BC455E	RNACentral
	URS0000EEBA79	RNACentral
	URS0000EEE488	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-10-08	LINC02869	long intergenic non-protein coding RNA 2869	C1orf143	chromosome 1 open reading frame 143 (putative)	Symbol and/or name change	5135510	APPROVED
2017-10-04	C1orf143	chromosome 1 open reading frame 143 (putative)		chromosome 1 open reading frame 143	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar