Symbol:
A430033K04Rik
Name:
RIKEN cDNA A430033K04 gene
RGD ID:
1622034
MGI Page
MGI
Description:
Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in regulation of osteoblast differentiation. Acts upstream of or within negative regulation of DNA-templated transcription. Located in nucleus. Is expressed in early conceptus; inner cell mass; and oocyte.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
C86988; expressed sequence C86988; hypothetical protein LOC243308; ObI-1; ObI1; osteoblast inducer-1; uncharacterized protein LOC243308; zinc finger protein OBI1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 138,621,121 - 138,647,179 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 138,621,121 - 138,650,676 (+) Ensembl GRCm39 Ensembl GRCm38 5 138,622,859 - 138,648,917 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 138,622,859 - 138,652,414 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 139,064,087 - 139,090,066 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 138,852,682 - 138,878,545 (+) NCBI MGSCv36 mm8 Celera 5 135,686,944 - 135,712,909 (+) NCBI Celera Cytogenetic Map 5 G2 NCBI cM Map 5 77.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
A430033K04Rik Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 138,621,121 - 138,647,179 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 138,621,121 - 138,650,676 (+) Ensembl GRCm39 Ensembl GRCm38 5 138,622,859 - 138,648,917 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 138,622,859 - 138,652,414 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 139,064,087 - 139,090,066 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 138,852,682 - 138,878,545 (+) NCBI MGSCv36 mm8 Celera 5 135,686,944 - 135,712,909 (+) NCBI Celera Cytogenetic Map 5 G2 NCBI cM Map 5 77.1 NCBI
ZNF649 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 51,889,235 - 51,905,017 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 51,889,235 - 51,905,040 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 52,392,488 - 52,408,270 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 57,084,300 - 57,100,059 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 19 49,442,054 - 49,457,871 (-) NCBI Celera Cytogenetic Map 19 q13.41 NCBI HuRef 19 48,723,139 - 48,738,956 (-) NCBI HuRef CHM1_1 19 52,394,327 - 52,410,144 (-) NCBI CHM1_1 T2T-CHM13v2.0 19 54,976,430 - 54,992,212 (-) NCBI T2T-CHM13v2.0
ZNF649 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 57,856,619 - 57,947,000 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 59,856,022 - 59,871,319 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 19 48,829,464 - 48,847,569 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 19 57,709,867 - 57,726,388 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 19 57,709,867 - 57,726,388 (-) Ensembl panpan1.1 panPan2
LOC100625694 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 58,217,487 - 58,232,742 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 58,217,468 - 58,231,765 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 51,958,771 - 51,972,871 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ZNF649 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 44,710,477 - 44,720,702 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 44,710,838 - 44,717,364 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666073 24,753,157 - 24,800,713 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
.
Predicted Target Of
Count of predictions: 489 Count of miRNA genes: 356 Interacting mature miRNAs: 394 Transcripts: ENSMUST00000032590, ENSMUST00000069862 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
27226719 Tibw6_m tibia width 6, proximal, 16 week (mouse) 5 72857343 139985755 Mouse 1301363 Pbwg13_m postnatal body weight growth 13 (mouse) Not determined 5 125133457 151758149 Mouse 1301715 Elmaz2_m elevated maze behavior 2 (mouse) Not determined 5 125178229 141700466 Mouse 1301362 Prnr1_m prion resistance 1 (mouse) Not determined 5 89418876 146787935 Mouse 10412191 Bbaa24_m B.burgdorferi-associated arthritis 24 (mouse) Not determined 5 119945037 141700466 Mouse 1300913 Bwefm_m body weight females and males day 10 (mouse) Not determined 5 109439348 143439459 Mouse 13464143 Bbaa2b_m B.burgdorferi-associated arthritis 2b (mouse) 5 133052969 140709801 Mouse 4141081 Nidd7k_m Nidd7 on KK-A (mouse) Not determined 119945037 149347326 Mouse 11528552 Scram1_m spinal cord resistance to astrocytoma modifier 1 (mouse) 5 121455402 151758149 Mouse 1300827 Cora1_m correlation in cytokine production 1 (mouse) Not determined 5 115156883 149157015 Mouse 10043890 Trigq4_m triglyceride QTL 4 (mouse) Not determined 5 107906299 141906412 Mouse 1302079 Lbw3_m lupus NZB x NZW 3 (mouse) Not determined 5 124700335 151758149 Mouse 10412239 Alpq7_m alcohol preference QTL 7 (mouse) Not determined 5 104705939 138705939 Mouse 1301986 Bpq4_m blood pressure QTL 4 (mouse) Not determined 5 121555236 151758149 Mouse 1301857 Bglq14_m body growth late QTL 14 (mouse) Not determined 5 118948964 151758149 Mouse 12880406 Jcdq2_m joint cartilage degeneration QTL 2 (mouse) 5 129787831 151758149 Mouse 1301543 Hypch_m hypercholesterolemia (mouse) Not determined 5 109238624 139118905 Mouse 4142473 Chlq11_m circulating hormone level QTL 11 (mouse) Not determined 5 107906299 141906412 Mouse 13464251 Ahl21_m age related hearing loss, early onset 21 (mouse) 5 109167240 143167381 Mouse 1301226 Bbaa2_m B.burgdorferi-associated arthritis 2 (mouse) Not determined 5 115156883 149157015 Mouse 10412197 Bbaa25_m B.burgdorferi-associated arthritis 25 (mouse) Not determined 5 109167240 143167381 Mouse 4141218 Ath24_m atherosclerosis 24 (mouse) Not determined 129520084 151758149 Mouse 11049557 Lmr26_m leishmaniasis resistance 26 (mouse) 5 133925558 151758149 Mouse 13464243 Ahl20_m age related hearing loss, early onset 20 (mouse) 5 107906299 141906412 Mouse
C86988
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 5 138,647,521 - 138,647,753 UniSTS GRCm38 MGSCv37 5 139,088,670 - 139,088,902 UniSTS GRCm37 Celera 5 135,711,588 - 135,711,820 UniSTS Cytogenetic Map 5 G2 UniSTS Whitehead/MRC_RH 5 1675.47 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000032590 ⟹ ENSMUSP00000032590
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 138,621,121 - 138,639,085 (+) Ensembl GRCm38.p6 Ensembl 5 138,622,859 - 138,640,823 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000069862 ⟹ ENSMUSP00000067316
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 138,621,156 - 138,647,098 (+) Ensembl GRCm38.p6 Ensembl 5 138,622,894 - 138,648,836 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000198958 ⟹ ENSMUSP00000142904
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 138,621,138 - 138,650,676 (+) Ensembl GRCm38.p6 Ensembl 5 138,622,876 - 138,652,414 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000200521 ⟹ ENSMUSP00000143566
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 138,621,121 - 138,639,085 (+) Ensembl GRCm38.p6 Ensembl 5 138,622,859 - 138,640,823 (+) Ensembl
RefSeq Acc Id:
NM_183025 ⟹ NP_898846
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 138,621,121 - 138,647,179 (+) NCBI GRCm38 5 138,622,859 - 138,648,917 (+) ENTREZGENE MGSCv37 5 139,064,087 - 139,090,066 (+) RGD Celera 5 135,686,944 - 135,712,909 (+) RGD cM Map 5 ENTREZGENE
Sequence:
GTCTGGGACCCTCCATATTGGAATCACTGTATGCTGCTAGGGAAGCTGTTGCTCAGCTTCGGTGGCGCGGTGACGCTGTAAGTGCTGGGCGATGGTGAGAAGACGCCAGCGGCTCCCAGAAGTGGACA
hide sequence
RefSeq Acc Id:
NP_898846 ⟸ NM_183025
- UniProtKB:
E9Q8G5 (UniProtKB/TrEMBL)
- Sequence:
MVRRRQRLPEVDMGLVSFEDVAVDFTWQEWQELDAAQRTLYRDVMLENYRSLVWLGHCLAKPELISKLEEGFEPWGVAEATEQCLPGVRKWSAPVEKGQQSQEKYLRQVKIIKKNTPDEDKVEVENTY
hide sequence
Ensembl Acc Id:
ENSMUSP00000142904 ⟸ ENSMUST00000198958
Ensembl Acc Id:
ENSMUSP00000032590 ⟸ ENSMUST00000032590
Ensembl Acc Id:
ENSMUSP00000067316 ⟸ ENSMUST00000069862
Ensembl Acc Id:
ENSMUSP00000143566 ⟸ ENSMUST00000200521
RGD ID: 6888528 Promoter ID: EPDNEW_M7715 Type: multiple initiation site Name: A430033K04Rik_1 Description: Mus musculus RIKEN cDNA A430033K04 gene , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 5 138,622,884 - 138,622,944 EPDNEW
RGD ID: 6836821 Promoter ID: MM_KWN:44571 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: ENSMUST00000032590, NM_183025, UC009AFT.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 5 139,063,776 - 139,064,276 (+) MPROMDB
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-04-05
A430033K04Rik
RIKEN cDNA A430033K04 gene
C86988
expressed sequence C86988
Data merged from RGD:1608568
737654 PROVISIONAL
