Symbol: |
4930455G09Rik |
Name: |
RIKEN cDNA 4930455G09 gene |
RGD ID: |
1609117 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
hypothetical protein LOC78917; uncharacterized protein LOC78917 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 4 | 141,745,209 - 141,756,306 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 4 | 141,731,071 - 141,756,963 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 4 | 142,017,898 - 142,028,995 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 4 | 142,017,898 - 142,028,996 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 4 | 143,834,006 - 143,845,338 (+) | NCBI | | Celera | | | Cytogenetic Map | 4 | D3 | NCBI | | | | | cM Map | 4 | 75.11 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 108 | Count of miRNA genes: | 102 | Interacting mature miRNAs: | 104 | Transcripts: | ENSMUST00000126231 | Prediction methods: | Microtar, Miranda, Rnahybrid | Result types: | miRGate_prediction |
1301267 | Bcmd2_m | B cell maturation defect 2 (mouse) | | | Not determined | | 4 | 133154678 | 150789451 | Mouse | 4142139 | Adip12_m | adiposity 12 (mouse) | | | Not determined | | 4 | 124621281 | 156860686 | Mouse | 10047132 | Albq19_m | albuminuria QTL 19 (mouse) | | | Not determined | | 4 | 112824389 | 146824389 | Mouse | 1301525 | Lmb1_m | lupus in MRL and B6 F2 cross (mouse) | | | Not determined | | 4 | 124264957 | 150676858 | Mouse | 14746982 | Manh56_m | mandible shape 56 (mouse) | | | | | 4 | 117815917 | 151815917 | Mouse | 25314312 | Syncl2_m | synaptonemal complex length 2 (mouse) | | | | | 4 | 65718237 | 146584457 | Mouse | 1300743 | Skull6_m | skull morphology 6 (mouse) | | | Not determined | | 4 | 111009051 | 145009280 | Mouse | 1301382 | Arvm2_m | autoimmune renal vasculitis 2 (mouse) | | | Not determined | | 4 | 107791564 | 141791756 | Mouse | 1302149 | Tlsr2_m | thymic lymphoma suppressor region 2 (mouse) | | | Not determined | | 4 | 124264957 | 142230960 | Mouse | 1300874 | Gasa2_m | gastritis type A susceptibility locus 2 (mouse) | | | Not determined | | 4 | 133010494 | 156860686 | Mouse | 27226757 | Femd1_m | femur midshaft diameter 1, 5 week (mouse) | | | | | 4 | 123993793 | 144326570 | Mouse | 1300621 | Tpnr1_m | thermal pain response 1 (mouse) | | | Not determined | | 4 | 125230872 | 156860686 | Mouse | 11567249 | Elorr3_m | ethanol induced loss of righting response 3 (mouse) | | | | | 4 | 3722677 | 156268235 | Mouse | 4142493 | Femwf13_m | femur work to failure 13 (mouse) | | | Not determined | | | 116154678 | 150154782 | Mouse | 1301815 | Sles2_m | systemic lupus erythmatosus suppressor 2 (mouse) | | | Not determined | | 4 | 94957579 | 150676858 | Mouse | 1300917 | Gasa1_m | gastritis type A susceptibility locus 1 (mouse) | | | Not determined | | 4 | 124055093 | 142438020 | Mouse | 1300537 | Ap3q_m | alcohol preference 3 QTL (mouse) | | | Not determined | | 4 | 134654451 | 156860686 | Mouse | 1301823 | Bmd7_m | bone mineral density 7 (mouse) | | | Not determined | | 4 | 88982069 | 151654550 | Mouse | 10412210 | Cypr6_m | cytokine production 6 (mouse) | | | Not determined | | 4 | 120617848 | 154617995 | Mouse | 1302078 | Sluc21_m | susceptibility to lung cancer 21 (mouse) | | | Not determined | | 4 | 117401141 | 151401275 | Mouse | 10045620 | Heal22_m | wound healing/regeneration 22 (mouse) | | | Not determined | | 4 | 125230872 | 156860686 | Mouse | 4142481 | Gct1_m | granulosa cell tumorigenesis 1 (mouse) | | | Not determined | | 4 | 127784226 | 156860686 | Mouse | 13503348 | Bntq18_m | bone traits QTL 18 (mouse) | | | | | 4 | 120617848 | 154617995 | Mouse | 13208562 | Wght7_m | weight 7 (mouse) | | | | | 4 | 90888237 | 148084457 | Mouse | 4141184 | Tb2r1_m | TGF-beta2 responsiveness 1 (mouse) | | | Not determined | | | 137674005 | 150676858 | Mouse | 1300780 | Cocrb16_m | cocaine related behavior 16 (mouse) | | | Not determined | | 4 | 138943725 | 156860686 | Mouse | 4142077 | Ignpq2_m | IgA nephropathy QTL 2 (mouse) | | | Not determined | | 4 | 133676733 | 156860686 | Mouse | 4141180 | Ssic1_m | susceptibility to small intestinal cancer 1 (mouse) | | | Not determined | | | 120674005 | 154674151 | Mouse | 1301584 | Lrdg2_m | light induced retinal degeneration 2 (mouse) | | | Not determined | | 4 | 129465811 | 151654550 | Mouse | 1302102 | Bis1_m | beta-carboline-induced seizures 1 (mouse) | | | Not determined | | 4 | 119864433 | 153864536 | Mouse | 10043996 | Gct5_m | granulosa cell tumorigenesis 5 (mouse) | | | Not determined | | 4 | 127784226 | 156860686 | Mouse | 26884445 | Sklq7_m | skull length QTL 7, 10 week (mouse) | | | | | 4 | 68018237 | 150884457 | Mouse | 10043985 | Stheal12_m | soft tissue heal 12 (mouse) | | | Not determined | | 4 | 121342649 | 155342753 | Mouse | 1357534 | Cinda3_m | cytokine induced activation 3 (mouse) | | | Not determined | | 4 | 137617848 | 142289472 | Mouse | 1301982 | Pltiq1_m | phospholipid transfer protein inducibility QTL 1 (mouse) | | | Not determined | | 4 | 124621281 | 156860686 | Mouse | 26884437 | Sklq13_m | skull length QTL 13, 16 week (mouse) | | | | | 4 | 57700000 | 155684457 | Mouse | 1300803 | Sluc6_m | susceptibility to lung cancer 6 (mouse) | | | Not determined | | 4 | 120674005 | 154674151 | Mouse | 4142061 | Chlq16_m | circulating hormone level QTL 16 (mouse) | | | Not determined | | 4 | 121342649 | 155342753 | Mouse | 1300933 | Cdcs9_m | cytokine deficiency colitis susceptibility 9 (mouse) | | | Not determined | | 4 | 125230872 | 156860686 | Mouse | 1300553 | Athsq1_m | atherosclerosis susceptibility QTL 1 (mouse) | | | Not determined | | 4 | 137617848 | 151654550 | Mouse | 1301964 | Bw8q2_m | body weight at 8 weeks QTL 2 (mouse) | | | Not determined | | 4 | 119864433 | 153864536 | Mouse | 1301452 | Elsgp1_m | elevated serum gp70 1 (mouse) | | | Not determined | | 4 | 121342649 | 155342753 | Mouse | 10755520 | Rbc1_m | red blood cell count 1 (mouse) | | | | | 4 | 108477692 | 142477692 | Mouse | 10755521 | Hct1_m | hematocrit 1 (mouse) | | | | | 4 | 108477692 | 142477692 | Mouse | 10755522 | Hgb1_m | hemoglobin 1 (mouse) | | | | | 4 | 108477692 | 142477692 | Mouse | 1301108 | Scon2_m | sucrose consumption 2 (mouse) | | | Not determined | | 4 | 134654451 | 156860686 | Mouse | 1300858 | Tafat_m | tally ho associated mesenteric fat pad weight (mouse) | | | Not determined | | 4 | 124621281 | 156860686 | Mouse | 10755531 | Lymph3_m | lymphocyte differential 3 (mouse) | | | | | 4 | 124553483 | 156860686 | Mouse | 11533916 | Mts1_m | mammary tumor susceptibility 1 (mouse) | | | | | 4 | 125289325 | 156860686 | Mouse | 1300839 | Dyscalc2_m | dystrophic cardiac calcinosis 2 (mouse) | | | Not determined | | 4 | 111009051 | 145009280 | Mouse | 4141001 | Tgq17_m | triglyceride QTL 17 (mouse) | | | Not determined | | | 112523489 | 146523489 | Mouse | 15039385 | Mvlq3_m | macrovesicular liver lesion QTL 3 (mouse) | | | | | 4 | 112182386 | 146182386 | Mouse |
Ensembl Acc Id: |
ENSMUST00000126231 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,140 - 141,756,963 (+) | Ensembl | GRCm38.p6 Ensembl | 4 | 142,017,898 - 142,028,996 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350806 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,731,071 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350807 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,742,091 - 141,756,621 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350808 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,742,117 - 141,756,616 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350809 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,742,313 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350810 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,324 - 141,756,960 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350811 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,295 - 141,756,621 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350812 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,206 - 141,756,621 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350813 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,359 - 141,756,621 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350814 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,197 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350815 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,213 - 141,756,306 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350816 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,295 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350817 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,306 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350818 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,313 - 141,756,309 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350819 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,324 - 141,756,315 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350820 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,341 - 141,756,310 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350821 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,381 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350822 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,415 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350823 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,337 - 141,756,221 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350824 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,746,180 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350825 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,323 - 141,748,163 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350826 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,337 - 141,748,162 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350827 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,753,817 - 141,756,311 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350828 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,325 - 141,746,021 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000350829 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 141,745,454 - 141,746,021 (+) | Ensembl |
|
RefSeq Acc Id: |
NR_131014 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 4 | 141,745,209 - 141,756,306 (+) | NCBI | GRCm38 | 4 | 142,017,898 - 142,028,995 (+) | NCBI |
|
Sequence: |
ACTCACAGAAGCTATGGGCCCCAAGGGAAGGAGGCGTGGGGACTGTGTGCCCAGGGAGATTAGGAAGTGAGAACAGATAACTCGCCCACTTGTGACCGATGAGTGAGCGACGCCCAGTCCACTCGGGC ACACAGTGGCTCTCTGAGGAACGTTTCATGGAGGTGCCCTTGTCTCCGTACAGAAGATTCTAGAAGGCTTTGGGTGTGTGTCTGTCAGTGGCAGAGCCGCTTCAGACGCTGGTGACTGTTTTGGGCTG GGCACTGTCGTCGAAGGTATGTTCAGCTATGACAGCCCAAGGACAGCTACTGAGGACATTTGCCTGCTTTTGAAGCTGCACACCGTTTCTGAATTCTCCGCAGCGCTGAGGCTTATCTCCGGGCGCCA CACCGTCTTATCTGAAGTTTTCTTCCTTTCGTCTTCCTGAGAAGATTTATAACCCAGAAAAGCCACGCCATGATTTCTGCTTCCAAAATTGTATTCTGGTTGTTTTATTTTGCTCCCTGTCCTCCGTT GGCTTCGAGGATGCTGTTGAGCAATCTACAAATTCCCAGAGTGTCTGTGACTTTGTAGGCACCGTTGGCCGTTATCTTTGCTGTGTCTTTTATAGAATGTTCATAAATTCCAGGTTA
hide sequence
|
RGD ID: | 6885358 |
Promoter ID: | EPDNEW_M6130 |
Type: | initiation region |
Name: | 4930455G09Rik_1 |
Description: | Mus musculus RIKEN cDNA 4930455G09 gene , long non-coding RNA. |
SO ACC ID: | SO:0000170 |
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 4 | 142,017,985 - 142,018,045 | EPDNEW |
|
|
|