Symbol:
Mir147
Name:
microRNA 147
RGD ID:
1608326
MGI Page
MGI
Description:
Acts upstream of or within BMP signaling pathway; cellular response to lipopolysaccharide; and negative regulation of inflammatory response. Is expressed in gut and pancreas. Orthologous to human MIR147B (microRNA 147b).
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Mirn; Mirn147; mmu-mir-1; mmu-mir-147
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 122,482,723 - 122,482,801 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 122,482,723 - 122,482,801 (+) Ensembl GRCm39 Ensembl GRCm38 2 122,640,803 - 122,640,881 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 122,640,803 - 122,640,881 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 122,466,539 - 122,466,617 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 2 123,819,621 - 123,819,699 (+) NCBI Celera Cytogenetic Map 2 E5 NCBI cM Map 2 60.64 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir147 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 122,482,723 - 122,482,801 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 122,482,723 - 122,482,801 (+) Ensembl GRCm39 Ensembl GRCm38 2 122,640,803 - 122,640,881 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 122,640,803 - 122,640,881 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 122,466,539 - 122,466,617 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 2 123,819,621 - 123,819,699 (+) NCBI Celera Cytogenetic Map 2 E5 NCBI cM Map 2 60.64 NCBI
MIR147B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 45,433,050 - 45,433,129 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 45,433,050 - 45,433,129 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 45,725,248 - 45,725,327 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 15 43,512,539 - 43,512,618 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 15 22,616,667 - 22,616,746 (+) NCBI Celera Cytogenetic Map 15 q21.1 NCBI HuRef 15 22,549,337 - 22,549,416 (+) NCBI HuRef CHM1_1 15 45,844,235 - 45,844,314 (+) NCBI CHM1_1 T2T-CHM13v2.0 15 43,241,222 - 43,241,301 (+) NCBI T2T-CHM13v2.0
Mir147 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 130,176,275 - 130,176,353 (+) NCBI GRCr8 mRatBN7.2 3 109,722,692 - 109,722,770 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 109,722,692 - 109,722,770 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 113,619,047 - 113,619,125 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 122,214,577 - 122,214,655 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 119,874,955 - 119,875,033 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 114,775,343 - 114,775,421 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 114,775,343 - 114,775,421 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 121,313,451 - 121,313,529 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 3 108,600,718 - 108,600,796 (+) NCBI Celera Cytogenetic Map 3 q35 NCBI
MIR147 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 30 11,800,621 - 11,800,706 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 30 11,800,621 - 11,800,706 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 30 11,791,764 - 11,791,849 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 30 11,937,937 - 11,938,022 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 30 11,859,007 - 11,859,092 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 30 11,965,506 - 11,965,591 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 30 12,085,704 - 12,085,789 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 22252 Count of gene targets: 9243 Count of transcripts: 15220 Interacting mature miRNAs: mmu-miR-147-3p, mmu-miR-147-5p Prediction methods: Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
1301905 Lgth2_m body length 2 (mouse) Not determined 2 111173704 145173821 Mouse 1302033 Nsv1_m Neuroadapted Sindbis viral RNA level 1 (mouse) Not determined 2 111623386 145623526 Mouse 12904007 Cfq7_m conditioned fear QTL 7 (mouse) 2 118356772 125048872 Mouse 13506762 Tbvq2_m trabecular bone volume QTL 2 (mouse) 2 115430481 124741920 Mouse 13824983 Vclq1_m curvilinear velocity QTL 1 (mouse) 2 61830344 136841920 Mouse 1301909 Smdq2_m segregation of mitochondrial DNA QTL 2 (mouse) Not determined 2 92778465 126778607 Mouse 11039520 Ltpr2h_m Leishmania tropica response 2h (mouse) 2 112212746 146213005 Mouse 11039521 Ltpr2g_m Leishmania tropica response 2g (mouse) 2 115212857 149212994 Mouse 12910799 Pwgrq2_m pre-weaning growth rate QTL 2 (mouse) 2 118589253 160611165 Mouse 1302174 Dssc2_m dextran sodium sulfate induced colitis QTL2 (mouse) Not determined 2 24224632 148700377 Mouse 12910795 Pwbwq5_m post-weaning body weight QTL 5 (mouse) 2 118589253 160611165 Mouse 27226761 Feml18_m femur length 18, 16 week (mouse) 2 94230345 154241920 Mouse 12910812 Pwgrq1_m pre-weaning growth rate QTL 1 (mouse) 2 118589253 160611165 Mouse 12910814 Pwbwq1_m pre-weaning body weight QTL 1 (mouse) 2 118589253 160611165 Mouse 4141854 T2dm2sa_m type 2 diabetes mellitus 2 in SMXA RI mice (mouse) Not determined 2 29307947 148374934 Mouse 12904935 Edlmmq2_m extensor digitorum longus muscle mass QTL 2 (mouse) 2 97210364 131210364 Mouse 1302071 Fembrs1_m femur breaking strength 1 (mouse) Not determined 2 100942930 134943090 Mouse 10045885 Cplaq15_m circadian period of locomotor activity 15 (mouse) Not determined 2 110916118 154354667 Mouse 1302203 Gvhd3_m graft-versus host disease 3 (mouse) Not determined 2 100942930 134943090 Mouse 1300793 Pcfm2_m periosteal circumference and femur length 2 (mouse) Not determined 2 111173704 145173821 Mouse 10412082 Hylaq1_m Hyperlocomotor activity related QTL 1 (mouse) Not determined 2 84013198 148667470 Mouse 1300798 Actre3_m activity response to ethanol 3 (mouse) Not determined 2 112024987 128173821 Mouse 5491197 Mobq5_m multigenic obesity QTL 5 (mouse) Not determined 2 65269746 162518926 Mouse 5491196 Mobq6_m multigenic obesity QTL 6 (mouse) Not determined 2 85724269 180896594 Mouse 1301415 Actre4_m activity response to ethanol 4 (mouse) Not determined 2 112024987 128173821 Mouse 1301029 T2dm3_m type 2 diabetes mellitus 3 (mouse) Not determined 2 114288075 132714157 Mouse 27226788 Feml13_m femur length 13, 10 week (mouse) 2 102630345 159941920 Mouse 1301295 Prdt1_m prion disease incubation time 1 (mouse) Not determined 2 116077623 150077741 Mouse 12904954 Gmmq2_m gastrocnemius muscle mass QTL 2 (mouse) 2 97210364 131210364 Mouse 11038696 Ltpr2f_m Leishmania tropica response 2f (mouse) 2 115212857 149212994 Mouse 1301330 Tbbmd2_m total body bone mineral density 2 (mouse) Not determined 2 100942930 134943090 Mouse 1301201 Chab1_m cholesterol absorption 1 (mouse) Not determined 2 111551028 145551163 Mouse 11038699 Ltpr2b_m Leishmania tropica response 2b (mouse) 2 112212746 146213005 Mouse 11038700 Ltpr2a_m Leishmania tropica response 2a (mouse) 2 112212746 146213005 Mouse 11038702 Ltpr2_m Leishmania tropica response 2 (mouse) 2 103095716 167212356 Mouse 11049568 Lmr28c_m leishmaniasis resistance 28c (mouse) 2 97123370 131123532 Mouse 11049569 Lmr28d_m leishmaniasis resistance 28d (mouse) 2 97123370 131123532 Mouse 11528549 Sluc31_m susceptibility to lung cancer 31 (mouse) 2 74524117 129213005 Mouse 1301087 Bbaa15_m B.burgdorferi-associated arthritis 15 (mouse) Not determined 2 110489658 144489807 Mouse 1301825 Pbrgcsf1_m peripheral blood stem cell response to granulocyte colony stimulating factor 1 (mouse) Not determined 2 106233580 140233729 Mouse 4141802 Ignpq1_m IgA nephropathy QTL 1 (mouse) Not determined 2 100824060 134824269 Mouse 1558990 Skmw9_m skeletal muscle weight 9 (mouse) Not determined 2 111173704 145173821 Mouse 11041906 Lmr28a_m leishmaniasis resistance 28a (mouse) 2 103095716 129213005 Mouse 4141155 Plast2b_m plasma plant sterol 2b (mouse) Not determined 2 84013198 148522175 Mouse 1301618 Bglu1_m blood glucose level 1 (mouse) Not determined 2 117942930 174324863 Mouse 1301755 Hrq1_m heart rate quantitative locus 1 (mouse) Not determined 2 111173704 145173821 Mouse 1301344 Lith1_m lithogenic gene 1 (mouse) Not determined 2 45347635 145312647 Mouse 1558881 Ses7_m salmonella enteritidis susceptibility 7 (mouse) Not determined 2 116306330 150306474 Mouse 1301098 Cd8mts3_m CD8 memory T cell subset 3 (mouse) Not determined 2 91089974 125090104 Mouse 10043875 Bw25_m body weight QTL 25 (mouse) Not determined 2 107255676 141255676 Mouse 1300712 El2_m epilepsy 2 (mouse) Not determined 2 122207146 142532135 Mouse
UniSTS:234511
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 2 122,640,760 - 122,640,867 UniSTS GRCm38 MGSCv37 2 122,466,496 - 122,466,603 UniSTS GRCm37 Celera 2 123,819,578 - 123,819,685 UniSTS Cytogenetic Map 2 E5 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000102354
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 2 122,482,723 - 122,482,801 (+) Ensembl GRCm38.p6 Ensembl 2 122,640,803 - 122,640,881 (+) Ensembl
RefSeq Acc Id:
NR_030547
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 2 122,482,723 - 122,482,801 (+) NCBI GRCm38 2 122,640,803 - 122,640,881 (+) ENTREZGENE MGSCv37 2 122,466,539 - 122,466,617 (+) RGD Celera 2 123,819,621 - 123,819,699 (+) RGD cM Map 2 ENTREZGENE
Sequence:
TATGAATCTAGTGGAAACATTTCTGCACAAACTAGATGTTGATGCCAGTGTGCGGAAATGCTTCTGCTACATTTGTAGG
hide sequence
RGD ID: 6878534 Promoter ID: EPDNEW_M2718 Type: multiple initiation site Name: Mir147_1 Description: Mus musculus microRNA 147 , microRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 2 122,640,873 - 122,640,933 EPDNEW
