Symbol:
Mir19a
Name:
microRNA 19a
RGD ID:
1608165
MGI Page
MGI
Description:
Acts upstream of or within several processes, including long-term synaptic potentiation; pre-B cell differentiation; and ventricular septum morphogenesis. Is expressed in several structures, including alimentary system; liver; lung; submandibular gland primordium; and yolk sac. Orthologous to human MIR19A (microRNA 19a).
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Mir; mir-19a; Mirn19a; mmu-mir-; mmu-mir-19a
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 115,281,432 - 115,281,513 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 115,281,432 - 115,281,513 (+) Ensembl GRCm39 Ensembl GRCm38 14 115,044,000 - 115,044,081 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 115,044,000 - 115,044,081 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 115,443,222 - 115,443,303 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 14 113,634,568 - 113,634,649 (+) NCBI Celera Cytogenetic Map 14 E4 NCBI cM Map 14 59.4 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir19a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 115,281,432 - 115,281,513 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 115,281,432 - 115,281,513 (+) Ensembl GRCm39 Ensembl GRCm38 14 115,044,000 - 115,044,081 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 115,044,000 - 115,044,081 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 115,443,222 - 115,443,303 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 14 113,634,568 - 113,634,649 (+) NCBI Celera Cytogenetic Map 14 E4 NCBI cM Map 14 59.4 NCBI
MIR19A Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 13 91,350,891 - 91,350,972 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 13 91,350,891 - 91,350,972 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 13 92,003,145 - 92,003,226 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 13 90,801,145 - 90,801,226 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 13 72,850,116 - 72,850,197 (+) NCBI Celera Cytogenetic Map 13 q31.3 NCBI HuRef 13 72,598,980 - 72,599,061 (+) NCBI HuRef CHM1_1 13 91,971,785 - 91,971,866 (+) NCBI CHM1_1 T2T-CHM13v2.0 13 90,553,467 - 90,553,548 (+) NCBI T2T-CHM13v2.0
Mir19a Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 98,588,131 - 98,588,212 (+) NCBI GRCr8 mRatBN7.2 15 92,180,912 - 92,180,993 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 92,180,912 - 92,180,993 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 96,087,701 - 96,087,782 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 97,220,567 - 97,220,648 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 94,127,973 - 94,128,054 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 100,180,162 - 100,180,243 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 100,180,162 - 100,180,243 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 103,641,185 - 103,641,266 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 15 91,045,592 - 91,045,673 (+) NCBI Celera Cytogenetic Map 15 q23 NCBI
MIR19A Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 22 42,478,298 - 42,478,355 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 22 42,478,285 - 42,478,366 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 22 42,333,986 - 42,334,043 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 22 42,879,547 - 42,879,604 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 22 42,879,534 - 42,879,615 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 22 42,562,020 - 42,562,077 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 22 42,616,399 - 42,616,456 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 22 42,617,462 - 42,617,519 (+) NCBI UU_Cfam_GSD_1.0
MIR19A Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 11 60,734,939 - 60,735,020 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 11 60,734,939 - 60,735,020 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 11 66,610,343 - 66,610,424 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Predicted Targets
Count of predictions: 23798 Count of gene targets: 8954 Count of transcripts: 14900 Interacting mature miRNAs: mmu-miR-19a-3p, mmu-miR-19a-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1357589 Kdnw2_m kidney weight 2 (mouse) Not determined 14 20887473 121269804 Mouse 4142508 Tgq25_m triglyceride QTL 25 (mouse) Not determined 85134068 119134068 Mouse 12903991 Opfaq4_m open field activity QTL 4 (mouse) 14 111211209 118699845 Mouse 12792981 Fbmd5_m femoral bone mineral density 5, females only (mouse) 14 99838217 125033054 Mouse 10755523 Hgb2_m hemoglobin 2 (mouse) 14 105884654 125139656 Mouse 12798541 Scvg3_m subcutaneous vessel growth QTL 3 (mouse) 14 105544636 117275989 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000083482
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 14 115,281,432 - 115,281,513 (+) Ensembl GRCm38.p6 Ensembl 14 115,044,000 - 115,044,081 (+) Ensembl
RefSeq Acc Id:
NR_029786
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 14 115,281,432 - 115,281,513 (+) NCBI GRCm38 14 115,044,000 - 115,044,081 (+) ENTREZGENE MGSCv37 14 115,443,222 - 115,443,303 (+) RGD Celera 14 113,634,568 - 113,634,649 (+) RGD cM Map 14 ENTREZGENE
Sequence:
GCAGCCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTGCAAATCTATGCAAAACTGATGGTGGCCTGC
hide sequence
