Symbol: |
4930441J16Rik |
Name: |
RIKEN cDNA 4930441J16 gene |
RGD ID: |
1608030 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
Astx1a; Astx1b; Astx1c; hypothetical protein LOC73962 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 2 | 74,129,284 - 74,138,061 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 2 | 74,127,095 - 74,138,078 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 2 | 74,298,940 - 74,307,717 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 2 | 74,298,940 - 74,307,717 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 2 | 75,987,400 - 75,996,194 (-) | NCBI | | Celera | | | Cytogenetic Map | 2 | C3 | NCBI | | | | | cM Map | 2 | 44.07 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 21 | Count of miRNA genes: | 21 | Interacting mature miRNAs: | 21 | Transcripts: | ENSMUST00000153743 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
13464141 | Hbbcq3_m | hemoglobin concentration QTL 3 (mouse) | | | | | 2 | 52448019 | 86448136 | Mouse | 13824983 | Vclq1_m | curvilinear velocity QTL 1 (mouse) | | | | | 2 | 61830344 | 136841920 | Mouse | 1301402 | Ap2q_m | alcohol preference 2 QTL (mouse) | | | Not determined | | 2 | 43520612 | 77520756 | Mouse | 1300761 | Lgth1_m | body length 1 (mouse) | | | Not determined | | 2 | 51703276 | 85703425 | Mouse | 4141236 | Hbnr5_m | Heligmosomoides bakeri nematode resistance 5 (mouse) | | | Not determined | | | 31214567 | 105143570 | Mouse | 1302174 | Dssc2_m | dextran sodium sulfate induced colitis QTL2 (mouse) | | | Not determined | | 2 | 24224632 | 148700377 | Mouse | 1301405 | Etohr_m | ethanol response acute (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse | 1301660 | Iba1_m | induction of brown adipocytes 1 (mouse) | | | Not determined | | 2 | 67647887 | 101648142 | Mouse | 1558915 | W3q1_m | weight 3 weeks QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 1300875 | Taste1_m | taste-saccharin preference 1 (mouse) | | | Not determined | | 2 | 50923175 | 84923278 | Mouse | 1301769 | Orgwq2_m | organ weight QTL 2 (mouse) | | | Not determined | | 2 | 3887126 | 93421651 | Mouse | 1357454 | Kidq1_m | kidney weight QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 1357577 | Trmq3_m | T cell ratio modifier QTL 3 (mouse) | | | Not determined | | 2 | 60520612 | 119355518 | Mouse | 1558966 | W10q9_m | weight 10 weeks QTL 9 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 4141854 | T2dm2sa_m | type 2 diabetes mellitus 2 in SMXA RI mice (mouse) | | | Not determined | | 2 | 29307947 | 148374934 | Mouse | 1300662 | Etohila_m | ethanol induced locomotor activity (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse | 1300788 | Cia2_m | collagen induced arthritis QTL 2 (mouse) | | | Not determined | | 2 | 43520612 | 77520756 | Mouse | 10053681 | Lith24_m | lithogenic gene 24 (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse | 1301048 | Actre2_m | activity response to ethanol 2 (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse | 1300671 | Cia4_m | collagen induced arthritis QTL 4 (mouse) | | | Not determined | | 2 | 43520612 | 77520756 | Mouse | 1357881 | Estoq1_m | embryo survival total QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 5491197 | Mobq5_m | multigenic obesity QTL 5 (mouse) | | | Not determined | | 2 | 65269746 | 162518926 | Mouse | 1301948 | Elsgp3_m | elevated serum gp70 3 (mouse) | | | Not determined | | 2 | 68724269 | 102724407 | Mouse | 1301411 | Pitm1_m | prion incubation time 1 (mouse) | | | Not determined | | 2 | 43520612 | 77520756 | Mouse | 4141069 | Pbwg1.5_m | postnatal body weight growth 1.5 (mouse) | | | Not determined | | | 43520612 | 77520756 | Mouse | 1558820 | Moo1_m | modifier of Odc1 (mouse) | | | Not determined | | 17 | 48269746 | 82269934 | Mouse | 12738429 | Lfibq18_m | liver fibrosis QTL 18 (mouse) | | | | | 2 | 57919991 | 91919991 | Mouse | 39128209 | Lwq14_m | liver weight QTL 14 (mouse) | | | | | 2 | 20897778 | 118894840 | Mouse | 1558738 | W6q1_m | weight 6 weeks QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 1300568 | Hdl1_m | high density lipoprotein (HDL) level 1 (mouse) | | | Not determined | | 2 | 48269746 | 82269934 | Mouse | 1301059 | Hrtfm1_m | heart failure modifier 1 (mouse) | | | Not determined | | 2 | 67591940 | 74964933 | Mouse | 1301703 | Bomd3_m | bone mineral density 3 (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse | 1301747 | Eae21_m | experimental allergic encephalomyelitis 21 (mouse) | | | Not determined | | 2 | 48269746 | 82269934 | Mouse | 1301235 | Alcw4_m | alcohol withdrawal 4 (mouse) | | | Not determined | | 2 | 48269746 | 82269934 | Mouse | 4141406 | Alpq2_m | alcohol preference QTL 2 (mouse) | | | Not determined | | 2 | 57524117 | 91524288 | Mouse | 10755526 | Lymph1_m | lymphocyte differential 1 (mouse) | | | | | 2 | 50819314 | 84819314 | Mouse | 13463471 | Hctq6_m | hematocrit QTL 6 (mouse) | | | | | 2 | 52448019 | 86448136 | Mouse | 1301873 | Hsl1_m | hyperoxia susceptibility locus 1 (mouse) | | | Not determined | | 2 | 63570154 | 97570301 | Mouse | 1558899 | Egq1_m | early growth QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 1357681 | Hrtq1_m | heart weight QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 1301109 | Dntcs2_m | dental caries susceptibility 2 (mouse) | | | Not determined | | 2 | 40885493 | 114910165 | Mouse | 1357436 | Splq1_m | spleen weight QTL 1 (mouse) | | | Not determined | | 2 | 20897778 | 118894840 | Mouse | 10755532 | Lymph5_m | lymphocyte differential 5 (mouse) | | | | | 2 | 44199017 | 78199017 | Mouse | 1301882 | Etohc2_m | ethanol consumption 2 (mouse) | | | Not determined | | 2 | 68724269 | 102724407 | Mouse | 11532740 | Pbwg1.10_m | postnatal body weight growth 1.10 (mouse) | | | | | 2 | 48132412 | 82132495 | Mouse | 1300577 | Capsq1_m | capsaicin sensitivity related QTL 1 (mouse) | | | Not determined | | 2 | 27602060 | 84013384 | Mouse | 1301344 | Lith1_m | lithogenic gene 1 (mouse) | | | Not determined | | 2 | 45347635 | 145312647 | Mouse | 13463482 | Mchq17_m | mean corpuscular hemoglobin QTL 17 (mouse) | | | | | 2 | 67647887 | 101648142 | Mouse | 1301480 | Pbwg1_m | postnatal body weight growth 1 (mouse) | | | Not determined | | 2 | 41820719 | 75820843 | Mouse | 10044002 | Hdl7_m | HDL level 7 (mouse) | | | Not determined | | 2 | 63005954 | 97006113 | Mouse |
D2Tfv5 |
Mouse Assembly | Chr | Position (strand) | Source | JBrowse |
---|
GRCm38 | 2 | 74,300,612 - 74,300,743 | UniSTS | GRCm38 | MGSCv37 | 2 | 74,138,669 - 74,138,800 | UniSTS | GRCm37 | Celera | 2 | 75,989,068 - 75,989,199 | UniSTS | | cM Map | 2 | | UniSTS | |
|
Ensembl Acc Id: |
ENSMUST00000153743 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,279 - 74,138,078 (-) | Ensembl | GRCm38.p6 Ensembl | 2 | 74,298,940 - 74,307,717 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261947 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,127,095 - 74,138,070 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261948 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,127,095 - 74,138,066 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261949 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,127,095 - 74,138,064 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261950 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,274 - 74,138,078 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261951 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,278 - 74,138,075 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261952 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,279 - 74,138,075 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261953 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,279 - 74,138,069 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261954 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,299 - 74,138,003 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261955 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,133,159 - 74,138,072 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261956 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,133,335 - 74,138,065 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261957 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,134,470 - 74,137,598 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261958 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,129,299 - 74,131,423 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000261959 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 2 | 74,137,139 - 74,138,069 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_040501 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 2 | 74,129,284 - 74,138,061 (-) | NCBI | GRCm38 | 2 | 74,298,940 - 74,307,717 (-) | ENTREZGENE | Celera | 2 | 75,987,400 - 75,996,194 (-) | ENTREZGENE | cM Map | 2 | | ENTREZGENE |
|
Sequence: |
GTCGGGGGATACAATCCTCTGAAACTGGTACTCACTCTGGAAGTGTCAAGCCTGTGAGATTGCTCAGTGGGTAAAGGTGCGTGCTACCAACCCTGAGGATCAGAGTCGGATCTCCAAGGCTCACATGG TACGGTGAAATGAGAGACAACCCTGGACAAGGAACAGTAGGACAGTCACAGTGCCTAAGCCAAAGGGCTATGTAAGTGGAGACTCAGAGTGAAGACACTGGAGAGACCCTGACATCCTTATTCTGACT CTTCCCTGGGTACTCCTGACAGCAGAGTGGTTAAGAAAAGTCTTGAAGCAAGCAGTTCAGTGGCTGGACCGCCACCTACTGGTCATTGTTAGCCACAACTGAGCCGTAGCTTAGGAAAAGAAGCTTTT TTCCTTAGGTGAGTCCATTCAATAATGACATTAAACCAAAGCCAAAGAAAAATAACTTTACCTAAAAATACGGATGAAGAACCGAACCAAATAAAATTAAGCTGATCTCTTAATAAATGTCTGTTTAT TGTT
hide sequence
|
RGD ID: | 6877640 |
Promoter ID: | EPDNEW_M2271 |
Type: | multiple initiation site |
Name: | 4930441J16Rik_1 |
Description: | Mus musculus RIKEN cDNA 4930441J16 gene , long non-coding RNA. |
SO ACC ID: | SO:0000170 |
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 2 | 74,307,697 - 74,307,757 | EPDNEW |
|
RGD ID: | 15092361 |
Promoter ID: | EPDNEWNC_M270 |
Type: | multiple initiation site |
Name: | 4930441J16Rik_1 |
Description: | RIKEN cDNA 4930441J16 gene [Source:MGISymbol;Acc:MGI:1921212] |
SO ACC ID: | SO:0000170 |
Source: | EPDNEWNC (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 2 | 74,307,697 - 74,307,757 | EPDNEWNC |
|
|
|