Symbol:
Mir487b
Name:
microRNA 487b
RGD ID:
1607582
MGI Page
MGI
Description:
Involved in energy homeostasis. Acts upstream of or within cellular response to phenylalanine; long-term synaptic potentiation; and sensory perception of sound. Orthologous to human MIR487B (microRNA 487b).
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
mir-487b; Mirn4; Mirn487b
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 12 109,693,767 - 109,693,848 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 12 109,693,767 - 109,693,848 (+) Ensembl GRCm39 Ensembl GRCm38 12 109,727,333 - 109,727,414 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 12 109,727,333 - 109,727,414 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 12 110,965,543 - 110,965,624 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 12 110,924,563 - 110,924,644 (+) NCBI Celera Cytogenetic Map 12 F1 NCBI cM Map 12 60.56 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir487b Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 12 109,693,767 - 109,693,848 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 12 109,693,767 - 109,693,848 (+) Ensembl GRCm39 Ensembl GRCm38 12 109,727,333 - 109,727,414 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 12 109,727,333 - 109,727,414 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 12 110,965,543 - 110,965,624 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 12 110,924,563 - 110,924,644 (+) NCBI Celera Cytogenetic Map 12 F1 NCBI cM Map 12 60.56 NCBI
MIR487B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 14 101,046,455 - 101,046,538 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 14 101,046,455 - 101,046,538 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 14 101,512,792 - 101,512,875 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 14 100,582,544 - 100,582,627 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 14 81,568,849 - 81,568,932 (+) NCBI Celera Cytogenetic Map 14 q32.31 NCBI HuRef 14 81,696,158 - 81,696,241 (+) NCBI HuRef CHM1_1 14 101,451,814 - 101,451,897 (+) NCBI CHM1_1 T2T-CHM13v2.0 14 95,281,832 - 95,281,915 (+) NCBI T2T-CHM13v2.0
Mir487b Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 6 134,562,890 - 134,562,971 (+) NCBI GRCr8 mRatBN7.2 6 128,741,485 - 128,741,566 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 6 128,741,485 - 128,741,566 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 6 128,920,724 - 128,920,805 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 6 129,216,556 - 129,216,637 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 6 128,578,179 - 128,578,260 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 6 133,877,124 - 133,877,205 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 6 133,877,124 - 133,877,205 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 6 143,039,481 - 143,039,562 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 6 126,325,864 - 126,325,945 (+) NCBI Celera Cytogenetic Map 6 q32 NCBI
MIR487B Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 8 69,275,496 - 69,275,553 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 8 69,275,473 - 69,275,576 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 8 68,793,643 - 68,793,700 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 8 69,557,144 - 69,557,201 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 8 69,220,689 - 69,220,746 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 8 69,286,784 - 69,286,841 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 8 69,684,783 - 69,684,840 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 5602 Count of gene targets: 3537 Count of transcripts: 5059 Interacting mature miRNAs: mmu-miR-487b-3p, mmu-miR-487b-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
39128213 Lwq23_m liver weight QTL 10 (mouse) 12 80956708 113383533 Mouse 1300883 Ath21_m atherosclerosis 21 (mouse) Not determined 12 85961579 119961683 Mouse 12910532 Nrq10a_m noise-induced hearing loss resistant QTL 10a (mouse) 12 92750025 120092757 Mouse 12910533 Nrq10_m noise-induced hearing loss resistant QTL 10 (mouse) 12 92750025 120092757 Mouse 1357463 Vtbt14_m vertebral trabecular bone trait 14 (mouse) Not determined 12 92936097 120092757 Mouse 1301269 Sluc12_m susceptibility to lung cancer 12 (mouse) Not determined 12 96860337 120092757 Mouse 4142007 Chlq17_m circulating hormone level QTL 17 (mouse) Not determined 12 88052874 120092757 Mouse 4142002 Tbqt3_m tibia bone quality traits 3 (mouse) Not determined 12 35285496 109936243 Mouse 11039526 Ccc1_m colitis susceptibility in the Collaborative Cross 1 (mouse) 12 93528334 111028223 Mouse 4141297 Plyid_m Polymeric IgA dominance (mouse) Not determined 109183385 115885122 Mouse 1300545 Lifespan3_m life span 3 (mouse) Not determined 12 88052874 120092757 Mouse 4141610 Tailaq1_m tail length adjusted QTL 1 (mouse) Not determined 80956708 113383533 Mouse 1301836 Heal5_m wound healing/regeneration 5 (mouse) Not determined 12 89939031 120092757 Mouse 13524846 Ppiq11_m prepulse inhibition QTL 11 (mouse) 12 82666396 116666396 Mouse 10412156 Nociq3_m nociceptive sensitivity inflammatory QTL 3 (mouse) Not determined 12 86396075 114831653 Mouse 13524842 Ppiq10a_m prepulse inhibition QTL 10a (mouse) 12 77512220 111512220 Mouse 1301879 Insq10_m insulin QTL 10 (mouse) Not determined 12 83532075 117532224 Mouse 10402491 Dipa4_m drug induced psychomotor activation 4 (mouse) Not determined 12 91222515 120092757 Mouse 1301492 Dbsty3_m diabesity 3 (mouse) Not determined 12 83532075 117532224 Mouse 4141335 W6q10_m weight 6 weeks QTL 10 (mouse) Not determined 80956708 113383533 Mouse 5491194 Mobq3_m multigenic obesity QTL 3 (mouse) Not determined 12 89664071 120092757 Mouse 1302138 Im6_m immunoregulatory 6 (mouse) Not determined 12 96860337 120092757 Mouse 1301308 Prdt4_m prion disease incubation time 4 (mouse) Not determined 12 88308354 120092757 Mouse 1301922 Bbaa6_m B.burgdorferi-associated arthritis 6 (mouse) Not determined 12 90308268 120092757 Mouse 1302177 Dps2_m delta power in slow-wave sleep 2 (mouse) Not determined 12 94146064 120092757 Mouse 10412075 Nils1_m neointima lesion size 1 (mouse) Not determined 12 102024665 120092757 Mouse 27226793 Feml10_m femur length 10, 5 week (mouse) 12 68346774 113363620 Mouse 4142401 Egq10_m early growth QTL 10 (mouse) Not determined 80956708 113383533 Mouse 1300973 Abmm_m antibody mediated myocarditis (mouse) Not determined 12 93264461 120092757 Mouse 13524849 Ppiq11a_m prepulse inhibition QTL 11a (mouse) 12 80989143 114989143 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000102265
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 12 109,693,767 - 109,693,848 (+) Ensembl GRCm38.p6 Ensembl 12 109,727,333 - 109,727,414 (+) Ensembl
RefSeq Acc Id:
NR_030271
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 12 109,693,767 - 109,693,848 (+) NCBI GRCm38 12 109,727,333 - 109,727,414 (+) ENTREZGENE MGSCv37 12 110,965,543 - 110,965,624 (+) RGD Celera 12 110,924,563 - 110,924,644 (+) RGD cM Map 12 ENTREZGENE
Sequence:
TGGTACTTGGAGAGTGGTTATCCCTGTCCTCTTCGCTTCACTCATGCCGAATCGTACAGGGTCATCCACTTTTTCAGTATCA
hide sequence
RGD ID: 8679266 Promoter ID: EPDNEW_M17664 Type: single initiation site Name: Mir487b_1 Description: Mus musculus microRNA 487b , microRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 12 109,727,357 - 109,727,417 EPDNEW
