Symbol:
Actr2
Name:
actin related protein 2
RGD ID:
1321953
MGI Page
MGI
Description:
Predicted to enable cytoskeletal protein binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to contribute to actin filament binding activity. Acts upstream of or within several processes, including cellular response to type II interferon; meiotic chromosome movement towards spindle pole; and meiotic cytokinesis. Located in actin cap. Is expressed in cochlea and metanephros. Orthologous to human ACTR2 (actin related protein 2).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
4921510D23Rik; A; AA409782; actin-like protein 2; actin-related protein 2; Arp2; ARP2 actin-related protein 2; ARP2 actin-related protein 2 homolog; D6Ertd746; D6Ertd746e; MGC36604
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ACTR2 (actin related protein 2) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Actr2 (actin related protein 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
ACTR2 (actin related protein 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
actr2b (actin related protein 2b)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid|ZFIN)
Danio rerio (zebrafish):
actr2a (actin related protein 2a)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Saccharomyces cerevisiae (baker's yeast):
ARP2
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Arp2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
arx-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
actr2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Related Pseudogenes:
Gm6828
Gm9729
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 20,012,304 - 20,062,951 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 20,012,304 - 20,062,913 (-) Ensembl GRCm39 Ensembl GRCm38 11 20,062,304 - 20,112,951 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 20,062,304 - 20,112,913 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 19,962,307 - 20,012,954 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 19,962,307 - 20,012,915 (-) NCBI MGSCv36 mm8 Celera 11 22,204,487 - 22,259,500 (-) NCBI Celera Cytogenetic Map 11 A3.1 NCBI cM Map 11 12.88 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Actr2 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1,2-Dimethylhydrazine results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Mouse 1,8-cineole multiple interactions EXP 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Mouse 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Mouse 17alpha-ethynylestradiol affects expression EXP 6480464 Ethinyl Estradiol affects the expression of ACTR2 mRNA CTD PMID:17555576 Actr2 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1310826 6480464 Tetrachlorodibenzodioxin results in decreased expression of ACTR2 mRNA CTD PMID:33387578 Actr2 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1310826 6480464 Tetrachlorodibenzodioxin affects the expression of ACTR2 mRNA CTD PMID:34747641 Actr2 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1310826 6480464 Tetrachlorodibenzodioxin results in increased expression of ACTR2 mRNA CTD PMID:32109520 Actr2 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of ACTR2 mRNA CTD PMID:24680724 Actr2 Mouse 2,6-dimethoxyphenol multiple interactions ISO RGD:1321952 6480464 [Sodium Chloride co-treated with pyrogallol 1,3-dimethyl ether] results in decreased expression of and affects the more ... CTD PMID:38598786 Actr2 Mouse 2-methylcholine affects expression ISO RGD:1321952 6480464 beta-methylcholine affects the expression of ACTR2 mRNA CTD PMID:21179406 Actr2 Mouse 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine increases expression ISO RGD:1310826 6480464 Puromycin Aminonucleoside results in increased expression of ACTR2 mRNA; Puromycin Aminonucleoside results in increased expression more ... CTD PMID:19617259 Actr2 Mouse 3,4-methylenedioxymethamphetamine decreases expression ISO RGD:1310826 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of ACTR2 mRNA CTD PMID:30071829 Actr2 Mouse 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO RGD:1321952 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 Actr2 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of ACTR2 mRNA CTD PMID:39298647 Actr2 Mouse 4,4'-sulfonyldiphenol increases expression ISO RGD:1321952 6480464 bisphenol S results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Mouse 6-propyl-2-thiouracil increases expression ISO RGD:1310826 6480464 Propylthiouracil results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse actinomycin D multiple interactions ISO RGD:1321952 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ACTR2 protein CTD PMID:38460933 Actr2 Mouse aflatoxin B1 increases methylation ISO RGD:1321952 6480464 Aflatoxin B1 results in increased methylation of ACTR2 gene CTD PMID:27153756 Actr2 Mouse aldehydo-D-glucose multiple interactions EXP 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Mouse aldehydo-D-glucose decreases expression EXP 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Mouse all-trans-retinoic acid increases expression ISO RGD:1321952 6480464 Tretinoin results in increased expression of ACTR2 mRNA CTD PMID:33167477 Actr2 Mouse aluminium oxide multiple interactions EXP 6480464 [Nanotubes, Carbon co-treated with Aluminum Oxide] results in increased secretion of ACTR2 protein CTD PMID:25598225 Actr2 Mouse amitrole increases expression ISO RGD:1310826 6480464 Amitrole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse Aroclor 1254 decreases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of ACTR2 mRNA CTD PMID:23650126 Actr2 Mouse bisphenol A increases expression ISO RGD:1310826 6480464 bisphenol A results in increased expression of ACTR2 mRNA CTD PMID:25181051|PMID:27571134|PMID:32145629 Actr2 Mouse bisphenol A increases expression ISO RGD:1321952 6480464 bisphenol A results in increased expression of ACTR2 protein CTD PMID:37567409 Actr2 Mouse bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ACTR2 protein CTD PMID:35999755 Actr2 Mouse bisphenol A decreases expression ISO RGD:1321952 6480464 bisphenol A results in decreased expression of ACTR2 protein CTD PMID:33376534 Actr2 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ACTR2 mRNA CTD PMID:33221593 Actr2 Mouse bisphenol AF increases expression ISO RGD:1321952 6480464 bisphenol AF results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Mouse Bisphenol B increases expression ISO RGD:1321952 6480464 bisphenol B results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Mouse bisphenol F multiple interactions ISO RGD:1321952 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 Actr2 Mouse bisphenol F increases expression ISO RGD:1321952 6480464 bisphenol F results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Mouse cadmium atom decreases expression ISO RGD:1321952 6480464 Cadmium results in decreased expression of ACTR2 mRNA CTD PMID:24284285 Actr2 Mouse carbon nanotube decreases expression EXP 6480464 Nanotubes, Carbon analog results in decreased expression of ACTR2 mRNA; Nanotubes, Carbon results in decreased more ... CTD PMID:25620056 Actr2 Mouse carbon nanotube multiple interactions EXP 6480464 [Nanotubes, Carbon co-treated with Aluminum Oxide] results in increased secretion of ACTR2 protein CTD PMID:25598225 Actr2 Mouse chloropicrin increases expression ISO RGD:1321952 6480464 chloropicrin results in increased expression of ACTR2 mRNA CTD PMID:26352163 Actr2 Mouse chlorpyrifos decreases expression EXP 6480464 Chlorpyrifos results in decreased expression of ACTR2 mRNA CTD PMID:37019170 Actr2 Mouse cobalt dichloride decreases expression ISO RGD:1321952 6480464 cobaltous chloride results in decreased expression of ACTR2 mRNA CTD PMID:19376846 Actr2 Mouse copper atom multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression more ... CTD PMID:15467011 Actr2 Mouse copper(0) multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression more ... CTD PMID:15467011 Actr2 Mouse D-glucose multiple interactions EXP 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Mouse D-glucose decreases expression EXP 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Mouse dexamethasone multiple interactions ISO RGD:1321952 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 Actr2 Mouse dextran sulfate decreases expression EXP 6480464 Dextran Sulfate results in decreased expression of ACTR2 protein CTD PMID:35999755 Actr2 Mouse dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of ACTR2 mRNA CTD PMID:21266533 Actr2 Mouse dibutyl phthalate increases expression ISO RGD:1310826 6480464 Dibutyl Phthalate results in increased expression of ACTR2 mRNA CTD PMID:21266533 Actr2 Mouse ethanol decreases expression ISO RGD:1310826 6480464 Ethanol results in decreased expression of ACTR2 protein CTD PMID:26185205 Actr2 Mouse folic acid multiple interactions EXP 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Mouse fumonisin B1 increases expression EXP 6480464 fumonisin B1 results in increased expression of ACTR2 mRNA CTD PMID:16221962 Actr2 Mouse furfural multiple interactions ISO RGD:1321952 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of more ... CTD PMID:38598786 Actr2 Mouse geldanamycin increases expression ISO RGD:1321952 6480464 geldanamycin results in increased expression of ACTR2 mRNA CTD PMID:26705709 Actr2 Mouse gentamycin increases expression ISO RGD:1310826 6480464 Gentamicins results in increased expression of ACTR2 mRNA CTD PMID:22061828 Actr2 Mouse glucose decreases expression EXP 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Mouse glucose multiple interactions EXP 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Mouse indometacin multiple interactions ISO RGD:1321952 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 Actr2 Mouse ivermectin decreases expression ISO RGD:1321952 6480464 Ivermectin results in decreased expression of ACTR2 protein CTD PMID:32959892 Actr2 Mouse methimazole increases expression ISO RGD:1310826 6480464 Methimazole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse methotrexate decreases expression ISO RGD:1321952 6480464 Methotrexate results in decreased expression of ACTR2 mRNA CTD PMID:25339124 Actr2 Mouse N,N-diethyl-m-toluamide multiple interactions ISO RGD:1310826 6480464 [Permethrin co-treated with DEET] results in decreased methylation of ACTR2 gene CTD PMID:33148267 Actr2 Mouse nickel atom increases expression ISO RGD:1321952 6480464 Nickel results in increased expression of ACTR2 mRNA CTD PMID:24768652|PMID:25583101 Actr2 Mouse nitrates multiple interactions EXP 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of ACTR2 more ... CTD PMID:35964746 Actr2 Mouse Nutlin-3 multiple interactions ISO RGD:1321952 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ACTR2 protein CTD PMID:38460933 Actr2 Mouse oxaliplatin multiple interactions ISO RGD:1310826 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ACTR2 mRNA CTD PMID:25729387 Actr2 Mouse ozone multiple interactions ISO RGD:1321952 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of ACTR2 mRNA CTD PMID:35430440 Actr2 Mouse paracetamol decreases expression ISO RGD:1310826 6480464 Acetaminophen results in decreased expression of ACTR2 mRNA CTD PMID:33387578 Actr2 Mouse permethrin multiple interactions ISO RGD:1310826 6480464 [Permethrin co-treated with DEET] results in decreased methylation of ACTR2 gene CTD PMID:33148267 Actr2 Mouse phenobarbital increases expression ISO RGD:1310826 6480464 Phenobarbital results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse pirinixic acid increases expression EXP 6480464 pirinixic acid results in increased expression of ACTR2 mRNA CTD PMID:16221962 Actr2 Mouse potassium dichromate decreases expression ISO RGD:1321952 6480464 Potassium Dichromate results in decreased expression of ACTR2 protein CTD PMID:23718831 Actr2 Mouse propiconazole increases expression ISO RGD:1310826 6480464 propiconazole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse resveratrol multiple interactions ISO RGD:1321952 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of ACTR2 mRNA CTD PMID:23557933 Actr2 Mouse rimonabant multiple interactions EXP 6480464 Rimonabant inhibits the reaction [Dietary Fats results in increased expression of ACTR2 mRNA] CTD PMID:19030233 Actr2 Mouse sodium arsenite decreases expression ISO RGD:1310826 6480464 sodium arsenite results in decreased expression of ACTR2 protein CTD PMID:29459688 Actr2 Mouse sodium chloride multiple interactions ISO RGD:1321952 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of more ... CTD PMID:38598786 Actr2 Mouse sulfadimethoxine increases expression ISO RGD:1310826 6480464 Sulfadimethoxine results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Mouse tamoxifen affects expression EXP 6480464 Tamoxifen affects the expression of ACTR2 mRNA CTD PMID:17555576 Actr2 Mouse tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of ACTR2 mRNA CTD PMID:31919559 Actr2 Mouse theophylline decreases expression ISO RGD:1321952 6480464 Theophylline results in decreased expression of ACTR2 mRNA CTD PMID:16083514 Actr2 Mouse thimerosal decreases expression ISO RGD:1321952 6480464 Thimerosal results in decreased expression of ACTR2 mRNA CTD PMID:27188386 Actr2 Mouse thioacetamide increases expression ISO RGD:1310826 6480464 Thioacetamide results in increased expression of ACTR2 mRNA CTD PMID:34492290 Actr2 Mouse thiram decreases expression ISO RGD:1321952 6480464 Thiram results in decreased expression of ACTR2 mRNA CTD PMID:38568856 Actr2 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of ACTR2 gene CTD PMID:35295148 Actr2 Mouse titanium dioxide increases methylation EXP 6480464 titanium dioxide results in increased methylation of ACTR2 promoter CTD PMID:35295148 Actr2 Mouse topotecan multiple interactions ISO RGD:1310826 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ACTR2 mRNA CTD PMID:25729387 Actr2 Mouse trichostatin A increases expression ISO RGD:1321952 6480464 trichostatin A results in increased expression of ACTR2 mRNA CTD PMID:24935251 Actr2 Mouse trichostatin A decreases expression ISO RGD:1310826 6480464 trichostatin A results in decreased expression of ACTR2 protein CTD PMID:12445420 Actr2 Mouse uranium atom affects expression ISO RGD:1321952 6480464 Uranium affects the expression of ACTR2 mRNA CTD PMID:15672453 Actr2 Mouse valproic acid decreases methylation ISO RGD:1321952 6480464 Valproic Acid results in decreased methylation of ACTR2 gene CTD PMID:29154799 Actr2 Mouse vinclozolin affects expression ISO RGD:1310826 6480464 vinclozolin affects the expression of ACTR2 mRNA CTD PMID:19015723 Actr2 Mouse vincristine increases expression ISO RGD:1321952 6480464 Vincristine results in increased expression of ACTR2 mRNA CTD PMID:23649840
Imported Annotations - PID (archival)
1,2-dimethylhydrazine (EXP) 1,8-cineole (EXP) 17alpha-ethynylestradiol (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 2-methylcholine (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) 6-propyl-2-thiouracil (ISO) actinomycin D (ISO) aflatoxin B1 (ISO) aldehydo-D-glucose (EXP) all-trans-retinoic acid (ISO) aluminium oxide (EXP) amitrole (ISO) Aroclor 1254 (EXP) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) cadmium atom (ISO) carbon nanotube (EXP) chloropicrin (ISO) chlorpyrifos (EXP) cobalt dichloride (ISO) copper atom (EXP) copper(0) (EXP) D-glucose (EXP) dexamethasone (ISO) dextran sulfate (EXP) dibutyl phthalate (EXP,ISO) ethanol (ISO) folic acid (EXP) fumonisin B1 (EXP) furfural (ISO) geldanamycin (ISO) gentamycin (ISO) glucose (EXP) indometacin (ISO) ivermectin (ISO) methimazole (ISO) methotrexate (ISO) N,N-diethyl-m-toluamide (ISO) nickel atom (ISO) nitrates (EXP) Nutlin-3 (ISO) oxaliplatin (ISO) ozone (ISO) paracetamol (ISO) permethrin (ISO) phenobarbital (ISO) pirinixic acid (EXP) potassium dichromate (ISO) propiconazole (ISO) resveratrol (ISO) rimonabant (EXP) sodium arsenite (ISO) sodium chloride (ISO) sulfadimethoxine (ISO) tamoxifen (EXP) tetrachloromethane (EXP) theophylline (ISO) thimerosal (ISO) thioacetamide (ISO) thiram (ISO) titanium dioxide (EXP) topotecan (ISO) trichostatin A (ISO) uranium atom (ISO) valproic acid (ISO) vinclozolin (ISO) vincristine (ISO)
1.
Arp2/3- and cofilin-coordinated actin dynamics is required for insulin-mediated GLUT4 translocation to the surface of muscle cells.
Chiu TT, etal., Mol Biol Cell. 2010 Oct 15;21(20):3529-39. doi: 10.1091/mbc.E10-04-0316. Epub 2010 Aug 25.
2.
Functional annotation of a full-length mouse cDNA collection.
Kawai J, etal., Nature. 2001 Feb 8;409(6821):685-90.
3.
Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development.
Ko MS, etal., Development 2000 Apr;127(8):1737-49.
4.
MGDs mouse GO annotations
MGD data from the GO Consortium
5.
Newly identified cytoskeletal components are associated with dynamic changes of podocyte foot processes.
Miao J, etal., Nephrol Dial Transplant. 2009 Nov;24(11):3297-305. doi: 10.1093/ndt/gfp338. Epub 2009 Jul 17.
6.
Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs.
Okazaki Y, etal., Nature. 2002 Dec 5;420(6915):563-73.
7.
Involvement of Arp2/3 complex in the process of colorectal carcinogenesis.
Otsubo T, etal., Mod Pathol. 2004 Apr;17(4):461-7.
8.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Paleocortex is specified in mice in which dorsal telencephalic patterning is severely disrupted.
Vyas A, etal., J Comp Neurol 2003 Nov 24;466(4):545-53.
11.
Relationship between learning and memory deficits and Arp2 expression in the hippocampus in rats with traumatic brain injury.
Xia X, etal., World Neurosurg. 2012 Dec;78(6):689-96. doi: 10.1016/j.wneu.2011.07.042. Epub 2011 Nov 7.
12.
Identification of the shared gene signatures between pulmonary fibrosis and pulmonary hypertension using bioinformatics analysis.
Zhao H, etal., Front Immunol. 2023 Sep 4;14:1197752. doi: 10.3389/fimmu.2023.1197752. eCollection 2023.
Actr2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 20,012,304 - 20,062,951 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 20,012,304 - 20,062,913 (-) Ensembl GRCm39 Ensembl GRCm38 11 20,062,304 - 20,112,951 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 20,062,304 - 20,112,913 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 19,962,307 - 20,012,954 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 19,962,307 - 20,012,915 (-) NCBI MGSCv36 mm8 Celera 11 22,204,487 - 22,259,500 (-) NCBI Celera Cytogenetic Map 11 A3.1 NCBI cM Map 11 12.88 NCBI
ACTR2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 65,227,831 - 65,271,253 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 65,227,788 - 65,271,253 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 65,454,965 - 65,498,387 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 65,308,406 - 65,351,891 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 65,366,552 - 65,410,036 NCBI Celera 2 65,301,566 - 65,345,120 (+) NCBI Celera Cytogenetic Map 2 p14 NCBI HuRef 2 65,189,074 - 65,232,629 (+) NCBI HuRef CHM1_1 2 65,386,192 - 65,429,751 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 65,237,506 - 65,280,921 (+) NCBI T2T-CHM13v2.0
Actr2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 98,500,119 - 98,535,092 (-) NCBI GRCr8 mRatBN7.2 14 94,296,443 - 94,333,735 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 94,296,443 - 94,340,524 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 98,639,283 - 98,680,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 99,879,572 - 99,920,537 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 96,346,941 - 96,387,904 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 104,338,486 - 104,375,840 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 104,340,434 - 104,375,649 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 104,072,596 - 104,109,950 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 100,848,391 - 100,883,833 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 100,867,618 - 100,903,044 (-) NCBI Celera 14 93,318,648 - 93,356,930 (-) NCBI Celera Cytogenetic Map 14 q22 NCBI
Actr2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 19,293,949 - 19,333,170 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 19,293,949 - 19,333,170 (-) NCBI ChiLan1.0 ChiLan1.0
ACTR2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 61,131,388 - 61,179,542 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 61,135,339 - 61,180,922 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 65,289,675 - 65,333,219 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 66,412,786 - 66,456,857 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 66,413,011 - 66,456,857 (+) Ensembl panpan1.1 panPan2
ACTR2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 64,696,068 - 64,733,027 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 64,696,111 - 64,730,553 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 64,582,083 - 64,619,025 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 65,705,072 - 65,742,073 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 65,705,085 - 65,742,062 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 65,383,665 - 65,420,656 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 65,691,644 - 65,728,572 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 65,986,809 - 66,023,812 (+) NCBI UU_Cfam_GSD_1.0
Actr2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 18,549,870 - 18,591,068 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936491 9,979,427 - 10,022,043 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936491 9,980,228 - 10,021,417 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ACTR2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 76,691,280 - 76,729,252 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 76,691,275 - 76,729,269 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 80,487,347 - 80,525,297 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ACTR2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 41,740,432 - 41,780,045 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 41,739,968 - 41,779,964 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 70,111,314 - 70,152,221 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Actr2
.
Predicted Target Of
Count of predictions: 914 Count of miRNA genes: 524 Interacting mature miRNAs: 625 Transcripts: ENSMUST00000000137, ENSMUST00000132022, ENSMUST00000134779 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1302171 Pgia28_m proteoglycan induced arthritis 28 (mouse) Not determined 11 8906097 42906218 Mouse 1357720 Kidpq1_m kidney weight percentage QTL 1 (mouse) Not determined 11 12268637 68500330 Mouse 1357722 Vtbt11_m vertebral trabecular bone trait 11 (mouse) Not determined 11 1 23880487 Mouse 1357851 Scfq3_m subcutaneous fat pad weight QTL 3 (mouse) Not determined 11 12268637 68500330 Mouse 27226762 Feml21_m femur length 21, 16 week (mouse) 11 11750000 65990826 Mouse 1301765 Skull15_m skull morphology 15 (mouse) Not determined 11 1 25976374 Mouse 4141470 Egq4_m early growth QTL 4 (mouse) Not determined 12268637 68500330 Mouse 13524844 Ppiq9_m prepulse inhibition QTL 9 (mouse) 11 9049997 35077325 Mouse 4142109 W10q2_m weight 10 weeks QTL 2 (mouse) Not determined 12268637 68500330 Mouse 1300661 Lmr6_m leishmaniasis resistance 6 (mouse) Not determined 11 1 25976374 Mouse 13208559 Wght10_m weight 10 (mouse) 11 3950000 88890826 Mouse 10412216 Eae44_m experimental allergic encephalomyelitis susceptibility 44 (mouse) Not determined 11 12268637 39950840 Mouse 13208558 Lgth12_m body length 12 (mouse) 11 3950000 94890826 Mouse 26884401 Huml4_m humerus length 4, 10 week (mouse) 11 11550000 68490826 Mouse 10053687 Eae6_m susceptibility to experimental allergic encephalomyelitis 6 (mouse) Not determined 11 17781966 68500330 Mouse 27226798 Scvln18_m sacral vertebrae length 2, 16 week (mouse) 11 3250000 60690826 Mouse 4141582 Lgaq1_m late growth adjusted QTL 1 (mouse) Not determined 12268637 68500330 Mouse 4141966 Tailq1_m tail length QTL 1 (mouse) Not determined 12268637 68500330 Mouse 1300768 Tshp9_m tooth shape 9 (mouse) Not determined 11 1 25976374 Mouse 10053676 Eae44a_m experimental allergic encephalomyelitis susceptibility 44a (mouse) Not determined 11 4507896 21379532 Mouse 1558945 Orgwq8_m organ weight QTL 8 (mouse) Not determined 11 17056175 67078411 Mouse 4142216 Lgq1_m late growth QTL 1 (mouse) Not determined 12268637 68500330 Mouse 1300905 Scc6_m colon tumor susceptibility 6 (mouse) Not determined 11 6880277 89019734 Mouse 14746971 Manh70_m mandible shape 70 (mouse) 11 19905890 53905890 Mouse 39128214 Lwq20_m liver weight QTL 20 (mouse) 11 12268637 118022724 Mouse 26884446 Sklq10_m skull length QTL 10, 10 week (mouse) 11 3250000 62890826 Mouse 4141047 Nilac1_m nicotine induced locomotor activity 1 (mouse) Not determined 11 9011780 43011942 Mouse 1559002 Lmrq4_m Leishmania major resistance QTL 4 (mouse) Not determined 11 12268637 69684947 Mouse 1300938 Bulb3_m bulb size 3 (mouse) Not determined 11 18578616 52578716 Mouse 1357518 Tgyl1_m triglyceride level 1 (mouse) Not determined 11 6880277 33916219 Mouse 4142308 W6q3_m weight 6 weeks QTL 3 (mouse) Not determined 11 12268637 68500330 Mouse 1357640 Orq2_m ovulation rate QTL 2 (mouse) Not determined 11 12268637 68500330 Mouse 1300599 Cocrb11_m cocaine related behavior 11 (mouse) Not determined 11 2670355 36671472 Mouse 1357437 Epfq4_m epididymal fat pad weight QTL 4 (mouse) Not determined 11 12268637 68500330 Mouse 27226741 Metcl5_m metatarsal-calcaneal length 5, 5 week (mouse) 11 4650000 46290827 Mouse 1300990 Bits3_m bitterness sensitivity 3 (mouse) Not determined 11 8372121 42372260 Mouse 27226738 Metcl11_m metatarsal-calcaneal length 11, 10 week (mouse) 11 8850000 61390826 Mouse 27226735 Metcl16_m metatarsal-calcaneal length 16, 16 week (mouse) 11 5250000 35090827 Mouse 12801459 Leuf1_m leukocyte filtration 1 (mouse) 11 18578616 52578716 Mouse 1300579 Thypr1_m thymocyte proliferative response 1 (mouse) Not determined 11 19282577 53282715 Mouse 10044008 Hbnr15_m Heligmosomoides bakeri nematode resistance 15 (mouse) Not determined 11 227052 34227232 Mouse 12801457 Intmrm2_m intima/media ratio modifier 2 (mouse) 11 18578616 52578716 Mouse 12801460 Intim2_m intima modifier 2 (mouse) 11 18578616 52578716 Mouse 27095909 Scvln6_m sacral vertebrae length 2, 5 week (mouse) 11 3250000 44090827 Mouse 4141127 W3q4_m weight 3 weeks QTL 4 (mouse) Not determined 12268637 68500330 Mouse 4141894 Nidd6k_m Nidd6 on KK-A (mouse) Not determined 19124204 96897826 Mouse 13463479 Mchq19_m mean corpuscular hemoglobin QTL 19 (mouse) 11 10951232 44951464 Mouse 27095904 Scvln12_m sacral vertebrae length 2, 10 week (mouse) 11 3250000 34495048 Mouse 13463472 Mcvq15_m mean corpuscular volume QTL 15 (mouse) 11 10951232 44951464 Mouse 26884453 Sklq16_m skull length QTL 16, 16 week (mouse) 11 3250000 72690826 Mouse
MDB0504
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 20,062,374 - 20,062,484 UniSTS GRCm38 MGSCv37 11 19,962,377 - 19,962,487 UniSTS GRCm37 Celera 11 22,204,557 - 22,204,667 UniSTS Cytogenetic Map 11 A3.1 UniSTS Whitehead_YAC 11 UniSTS
RH125883
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 20,062,366 - 20,062,615 UniSTS GRCm38 MGSCv37 11 19,962,369 - 19,962,618 UniSTS GRCm37 Celera 11 22,204,549 - 22,204,798 UniSTS Cytogenetic Map 11 A3.1 UniSTS Whitehead/MRC_RH 11 381.6 UniSTS
D6Ertd746e
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 11 A3.1 UniSTS cM Map 6 31.5 UniSTS cM Map 6 UniSTS cM Map 11 31.5 UniSTS
RH141392
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 97,161,710 - 97,161,908 UniSTS GRCm38 MGSCv37 11 97,023,024 - 97,023,222 UniSTS GRCm37 Celera 11 22,261,026 - 22,261,224 UniSTS Celera 11 106,814,630 - 106,814,828 UniSTS Cytogenetic Map 11 A3.1 UniSTS Cytogenetic Map 11 D UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000000137 ⟹ ENSMUSP00000000137
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 20,012,304 - 20,062,913 (-) Ensembl GRCm38.p6 Ensembl 11 20,062,304 - 20,112,913 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000132022
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 20,028,686 - 20,062,867 (-) Ensembl GRCm38.p6 Ensembl 11 20,078,686 - 20,112,867 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000134779
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 20,050,587 - 20,062,909 (-) Ensembl GRCm38.p6 Ensembl 11 20,100,587 - 20,112,909 (-) Ensembl
RefSeq Acc Id:
NM_001362899 ⟹ NP_001349828
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 20,012,304 - 20,062,951 (-) NCBI GRCm38 11 20,062,304 - 20,112,951 (-) NCBI
Sequence:
GGGCGGGGACTTCCGGTTTGGGCGGAGCGGCGGGCCGAGGGCGGGGCCGTGTGGAGGAGGAAGCAGGCCAGGCCGGGCGGCGGCTCACCAGGACGAACCATGGACAGCCAGGGCAGGAAGGTGGTGGT
hide sequence
RefSeq Acc Id:
NM_146243 ⟹ NP_666355
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 20,012,304 - 20,062,951 (-) NCBI GRCm38 11 20,062,304 - 20,112,951 (-) ENTREZGENE MGSCv37 11 19,962,307 - 20,012,954 (-) RGD Celera 11 22,204,487 - 22,259,500 (-) RGD cM Map 11 ENTREZGENE
Sequence:
GGGCGGGGACTTCCGGTTTGGGCGGAGCGGCGGGCCGAGGGCGGGGCCGTGTGGAGGAGGAAGCAGGCCAGGCCGGGCGGCGGCTCACCAGGACGAACCATGGACAGCCAGGGCAGGAAGGTGGTGGT
hide sequence
RefSeq Acc Id:
NP_666355 ⟸ NM_146243
- Peptide Label:
isoform 2
- UniProtKB:
Q6PI31 (UniProtKB/Swiss-Prot), P61161 (UniProtKB/Swiss-Prot), Q5SW83 (UniProtKB/TrEMBL)
- Sequence:
MDSQGRKVVVCDNGTGFVKCGYAGSNFPEHIFPALVGRPIIRSTTKVGNIEIKDLMVGDEASELRSMLEVNYPMENGIVRNWDDMKHLWDYTFGPEKLNIDTRNCKILLTEPPMNPTKNREKIVEVMF
hide sequence
RefSeq Acc Id:
NP_001349828 ⟸ NM_001362899
- Peptide Label:
isoform 1
Ensembl Acc Id:
ENSMUSP00000000137 ⟸ ENSMUST00000000137
RGD ID: 6820281 Promoter ID: MM_KWN:6558 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day3, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: NM_146243_ACTR2, OTTMUST00000011647, OTTMUST00000011649, UC007ICS.1, UC007ICT.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 20,012,426 - 20,013,227 (-) MPROMDB
RGD ID: 8674046 Promoter ID: EPDNEW_M15053 Type: initiation region Name: Actr2_1 Description: Mus musculus ARP2 actin-related protein 2 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 11 20,112,887 - 20,112,947 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2023-12-19
Actr2
actin related protein 2
Actr2
ARP2 actin-related protein 2
Symbol and/or name change
5135510 APPROVED
2012-07-10
Actr2
ARP2 actin-related protein 2
Actr2
ARP2 actin-related protein 2 homolog (yeast)
Symbol and/or name change
5135510 APPROVED
