Symbol:
Mau2
Name:
MAU2 sister chromatid cohesion factor
RGD ID:
1308759
Description:
Predicted to enable cohesin loader activity. Predicted to be involved in maintenance of mitotic sister chromatid cohesion. Predicted to be located in nuclear body. Predicted to be part of Scc2-Scc4 cohesin loading complex. Predicted to be active in chromatin. Orthologous to human MAU2 (MAU2 sister chromatid cohesion factor); INTERACTS WITH 2,2',5,5'-tetrachlorobiphenyl; amitrole; bisphenol A.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
hypothetical protein LOC290668; LOC290668; Mau2 chromatid cohesion factor homolog; Mau2 chromatid cohesion factor homolog (C. elegans); RGD1308759; similar to KIAA0892 protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 19,417,812 - 19,448,922 (+) NCBI GRCr8 mRatBN7.2 16 19,383,847 - 19,414,996 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 19,383,492 - 19,408,727 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 19,424,085 - 19,455,181 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 20,555,808 - 20,586,932 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 19,477,059 - 19,508,155 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 21,132,115 - 21,163,257 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 21,132,147 - 21,163,257 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 21,047,433 - 21,078,542 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 19,867,097 - 19,895,132 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 19,867,127 - 19,892,846 (+) NCBI Celera 16 19,572,963 - 19,604,071 (+) NCBI Celera Cytogenetic Map 16 p14 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mau2 Rat 1,2-dimethylhydrazine decreases expression ISO RGD:1318718 6480464 1,2-Dimethylhydrazine results in decreased expression of MAU2 mRNA CTD PMID:22206623 Mau2 Rat 2,2',5,5'-tetrachlorobiphenyl increases expression EXP 6480464 2,5,2',5'-tetrachlorobiphenyl results in increased expression of MAU2 mRNA CTD PMID:23829299 Mau2 Rat 4,4'-sulfonyldiphenol increases methylation ISO RGD:1318718 6480464 bisphenol S results in increased methylation of MAU2 exon CTD PMID:33297965 Mau2 Rat 4-hydroxyphenyl retinamide increases expression ISO RGD:1318718 6480464 Fenretinide results in increased expression of MAU2 mRNA CTD PMID:28973697 Mau2 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of MAU2 mRNA CTD PMID:30047161|PMID:38685447 Mau2 Rat aristolochic acid A increases expression ISO RGD:1318717 6480464 aristolochic acid I results in increased expression of MAU2 mRNA CTD PMID:33212167 Mau2 Rat arsane multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat arsenic atom multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat arsenite(3-) multiple interactions ISO RGD:1318717 6480464 arsenite inhibits the reaction [G3BP1 protein binds to MAU2 mRNA] CTD PMID:32406909 Mau2 Rat arsenous acid decreases expression ISO RGD:1318717 6480464 Arsenic Trioxide results in decreased expression of MAU2 mRNA CTD PMID:22521957 Mau2 Rat atrazine decreases expression ISO RGD:1318717 6480464 Atrazine results in decreased expression of MAU2 mRNA CTD PMID:22378314 Mau2 Rat bisphenol A decreases expression ISO RGD:1318717 6480464 bisphenol A results in decreased expression of MAU2 mRNA CTD PMID:25047013 Mau2 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MAU2 mRNA CTD PMID:35192832 Mau2 Rat bisphenol A decreases methylation ISO RGD:1318717 6480464 bisphenol A results in decreased methylation of MAU2 gene CTD PMID:31601247 Mau2 Rat bisphenol A increases expression ISO RGD:1318718 6480464 bisphenol A results in increased expression of MAU2 mRNA CTD PMID:33221593 Mau2 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MAU2 mRNA CTD PMID:34947998|PMID:38750585 Mau2 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MAU2 mRNA CTD PMID:25181051 Mau2 Rat Bisphenol A diglycidyl ether affects splicing ISO RGD:1318718 6480464 bisphenol A diglycidyl ether affects the splicing of MAU2 mRNA CTD PMID:36464114 Mau2 Rat bisphenol AF affects splicing ISO RGD:1318718 6480464 bisphenol AF affects the splicing of MAU2 mRNA CTD PMID:36464114 Mau2 Rat bisphenol F decreases expression ISO RGD:1318718 6480464 bisphenol F results in decreased expression of MAU2 mRNA CTD PMID:38685157 Mau2 Rat crocidolite asbestos decreases expression ISO RGD:1318718 6480464 Asbestos, Crocidolite results in decreased expression of MAU2 mRNA CTD PMID:29279043 Mau2 Rat diarsenic trioxide decreases expression ISO RGD:1318717 6480464 Arsenic Trioxide results in decreased expression of MAU2 mRNA CTD PMID:22521957 Mau2 Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of MAU2 mRNA CTD PMID:21551480 Mau2 Rat elemental selenium decreases expression ISO RGD:1318717 6480464 Selenium results in decreased expression of MAU2 mRNA CTD PMID:19244175 Mau2 Rat epoxiconazole decreases expression ISO RGD:1318718 6480464 epoxiconazole results in decreased expression of MAU2 mRNA CTD PMID:35436446 Mau2 Rat ethanol affects splicing ISO RGD:1318718 6480464 Ethanol affects the splicing of MAU2 mRNA CTD PMID:30319688 Mau2 Rat fenthion increases expression ISO RGD:1318718 6480464 Fenthion results in increased expression of MAU2 mRNA CTD PMID:34813904 Mau2 Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of MAU2 mRNA CTD PMID:30307764 Mau2 Rat furan decreases expression EXP 6480464 furan results in decreased expression of MAU2 mRNA CTD PMID:25539665 Mau2 Rat hexane decreases methylation EXP 6480464 n-hexane results in decreased methylation of MAU2 promoter CTD PMID:23740543 Mau2 Rat manganese atom multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat manganese(0) multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat manganese(II) chloride multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat methamphetamine increases expression ISO RGD:1318718 6480464 Methamphetamine results in increased expression of MAU2 mRNA CTD PMID:26307267 Mau2 Rat methidathion increases expression ISO RGD:1318718 6480464 methidathion results in increased expression of MAU2 mRNA CTD PMID:34813904 Mau2 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of MAU2 mRNA CTD PMID:30047161 Mau2 Rat methyl methanesulfonate increases expression ISO RGD:1318717 6480464 Methyl Methanesulfonate results in increased expression of MAU2 mRNA CTD PMID:23649840 Mau2 Rat ozone multiple interactions ISO RGD:1318717 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of MAU2 mRNA CTD PMID:35430440 Mau2 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of MAU2 mRNA CTD PMID:33387578 Mau2 Rat PCB138 decreases expression EXP 6480464 2,2',3',4,4',5-hexachlorobiphenyl results in decreased expression of MAU2 mRNA CTD PMID:23829299 Mau2 Rat perfluorohexanesulfonic acid decreases expression ISO RGD:1318718 6480464 perfluorohexanesulfonic acid results in decreased expression of MAU2 mRNA CTD PMID:37995155 Mau2 Rat phenobarbital affects expression ISO RGD:1318718 6480464 Phenobarbital affects the expression of MAU2 mRNA CTD PMID:23091169 Mau2 Rat pirinixic acid multiple interactions ISO RGD:1318717 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in more ... CTD PMID:19710929 Mau2 Rat potassium dichromate increases expression ISO RGD:1318718 6480464 Potassium Dichromate results in increased expression of MAU2 mRNA CTD PMID:23608068 Mau2 Rat propiconazole decreases expression EXP 6480464 propiconazole results in decreased expression of MAU2 mRNA CTD PMID:30047161 Mau2 Rat selenium atom decreases expression ISO RGD:1318717 6480464 Selenium results in decreased expression of MAU2 mRNA CTD PMID:19244175 Mau2 Rat sodium arsenite multiple interactions ISO RGD:1318717 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Mau2 Rat trichostatin A decreases expression ISO RGD:1318717 6480464 trichostatin A results in decreased expression of MAU2 mRNA CTD PMID:28542535 Mau2 Rat triphenyl phosphate affects expression ISO RGD:1318717 6480464 triphenyl phosphate affects the expression of MAU2 mRNA CTD PMID:37042841 Mau2 Rat triptonide increases expression ISO RGD:1318718 6480464 triptonide results in increased expression of MAU2 mRNA CTD PMID:33045310 Mau2 Rat triticonazole decreases expression EXP 6480464 triticonazole results in decreased expression of MAU2 mRNA CTD PMID:36084822 Mau2 Rat valproic acid affects expression ISO RGD:1318717 6480464 Valproic Acid affects the expression of MAU2 mRNA CTD PMID:25979313 Mau2 Rat valproic acid decreases expression ISO RGD:1318717 6480464 Valproic Acid results in decreased expression of MAU2 mRNA CTD PMID:28001369 Mau2 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of MAU2 mRNA CTD PMID:23034163 Mau2 Rat vitamin E decreases expression ISO RGD:1318717 6480464 Vitamin E results in decreased expression of MAU2 mRNA CTD PMID:19244175
Mau2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 19,417,812 - 19,448,922 (+) NCBI GRCr8 mRatBN7.2 16 19,383,847 - 19,414,996 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 19,383,492 - 19,408,727 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 19,424,085 - 19,455,181 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 20,555,808 - 20,586,932 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 19,477,059 - 19,508,155 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 21,132,115 - 21,163,257 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 21,132,147 - 21,163,257 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 21,047,433 - 21,078,542 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 19,867,097 - 19,895,132 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 19,867,127 - 19,892,846 (+) NCBI Celera 16 19,572,963 - 19,604,071 (+) NCBI Celera Cytogenetic Map 16 p14 NCBI
MAU2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 19,320,829 - 19,358,754 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 19,320,829 - 19,358,754 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 19,431,638 - 19,469,563 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 19,292,630 - 19,330,563 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 19 19,335,703 - 19,373,641 (+) NCBI Celera Cytogenetic Map 19 p13.11 NCBI HuRef 19 18,994,938 - 19,032,220 (+) NCBI HuRef CHM1_1 19 19,432,396 - 19,470,333 (+) NCBI CHM1_1 T2T-CHM13v2.0 19 19,458,285 - 19,496,258 (+) NCBI T2T-CHM13v2.0
Mau2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 70,465,896 - 70,495,384 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 70,468,773 - 70,495,384 (-) Ensembl GRCm39 Ensembl GRCm38 8 70,014,527 - 70,042,734 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 70,016,123 - 70,042,734 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 72,540,022 - 72,566,633 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 72,947,571 - 72,971,723 (-) NCBI MGSCv36 mm8 Celera 8 72,576,416 - 72,603,020 (-) NCBI Celera Cytogenetic Map 8 B3.3 NCBI cM Map 8 34.15 NCBI
Mau2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955524 2,539,623 - 2,563,625 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955524 2,539,623 - 2,563,627 (-) NCBI ChiLan1.0 ChiLan1.0
MAU2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 24,182,700 - 24,220,858 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 23,189,133 - 23,227,100 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 19 18,758,730 - 18,796,736 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 19 19,762,540 - 19,799,706 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 19 19,762,540 - 19,799,706 (+) Ensembl panpan1.1 panPan2
MAU2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 20 43,863,996 - 43,891,442 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 20 43,866,660 - 43,891,450 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 20 43,781,134 - 43,808,586 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 20 44,351,862 - 44,379,323 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 20 44,351,226 - 44,379,305 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 20 43,589,373 - 43,616,840 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 20 43,998,996 - 44,026,439 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 20 44,274,237 - 44,301,693 (-) NCBI UU_Cfam_GSD_1.0
Mau2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 202,548,182 - 202,583,821 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936596 2,096,880 - 2,133,363 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936596 2,097,323 - 2,132,967 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MAU2
MAU2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 17,784,455 - 17,820,270 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 17,784,489 - 17,817,285 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666074 1,486,597 - 1,522,384 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mau2
.
Predicted Target Of
Count of predictions: 648 Count of miRNA genes: 282 Interacting mature miRNAs: 364 Transcripts: ENSRNOT00000027846 Prediction methods: Microtar, Miranda, Targetscan Result types: miRGate_prediction
631561 Hcuc2 Hepatic copper content QTL 2 2.8 liver copper amount (VT:0003065) liver total copper weight (CMO:0001507) 16 1 39533949 Rat 1582235 Insul8 Insulin level QTL 8 3.3 0.0063 blood insulin amount (VT:0001560) calculated serum insulin level (CMO:0000359) 16 1 26727669 Rat 70215 Niddm29 Non-insulin dependent diabetes mellitus QTL 29 3.54 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 16 19004435 75226532 Rat 2307172 Activ4 Activity QTL 4 3.71 0.00023 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 16 1 33418960 Rat 1354584 Despr6 Despair related QTL 6 3.1 0.0067 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 39533930 Rat 2302380 Slep6 Serum leptin concentration QTL 6 3.36 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 1 32139025 Rat 737819 Hcas4 Hepatocarcinoma susceptibility QTL 4 4.43 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 16 4227609 46975965 Rat 631517 Scl9 Serum cholesterol level QTL 9 3.3 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 16 15726433 21034895 Rat 9590151 Scort8 Serum corticosterone level QTL 8 8.45 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 16 1 30836262 Rat 1354625 Despr7 Despair related QTL 7 3.16 0.016 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 44977551 Rat 61338 Bp23 Blood pressure QTL 23 4.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 4227609 49227609 Rat 61405 Niddm6 Non-insulin dependent diabetes mellitus QTL 6 3.66 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 16 4227609 48972724 Rat 631830 Alc7 Alcohol consumption QTL 7 2.9 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 1 26727669 Rat 7411664 Foco30 Food consumption QTL 30 11 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 16 1 44588133 Rat 1600378 Arunc4 Aerobic running capacity QTL 4 0.03 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 380245 80345693 Rat 70183 BpQTLcluster13 Blood pressure QTL cluster 13 3.654 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 16 4227609 43025077 Rat 1600369 Hcas8 Hepatocarcinoma susceptibility QTL 8 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 16 1 22477621 Rat 737826 Alc11 Alcohol consumption QTL 11 3.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 60252231 Rat 2303566 Bw90 Body weight QTL 90 2 body mass (VT:0001259) body weight (CMO:0000012) 16 1 39533930 Rat 2312663 Slep9 Serum leptin concentration QTL 9 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 832236 59492508 Rat 2306902 Bp339 Blood pressure QTL 339 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 3380150 43025077 Rat 1300133 Rf24 Renal function QTL 24 3.64 blood creatinine amount (VT:0005328) creatinine clearance (CMO:0000765) 16 3380150 21361552 Rat 2312660 Bw95 Body weight QTL 95 0.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 16 832236 59492508 Rat 2312666 Insul16 Insulin level QTL 16 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 16 832236 59492508 Rat 634355 Rends4 Renal damage susceptibility QTL 4 0.05 kidney blood vessel morphology trait (VT:0000530) organ lesion measurement (CMO:0000677) 16 1 26727669 Rat 70205 Gcr3 Gastric cancer resistance QTL 3 2.3 stomach morphology trait (VT:0000470) stomach tumor diameter (CMO:0001889) 16 17696791 82635055 Rat 2293343 Glom16 Glomerulus QTL 16 7.4 kidney glomerulus integrity trait (VT:0010546) kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269) 16 832236 46053497 Rat 6903319 Bw114 Body weight QTL 114 2.7 0.0037 body mass (VT:0001259) body weight (CMO:0000012) 16 1 43534949 Rat 2312669 Stl23 Serum triglyceride level QTL 23 0.01 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 16 832236 59492508 Rat
RH132588
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 16 19,411,629 - 19,411,840 (+) MAPPER mRatBN7.2 Rnor_6.0 16 21,159,891 - 21,160,101 NCBI Rnor6.0 Rnor_5.0 16 21,075,176 - 21,075,386 UniSTS Rnor5.0 RGSC_v3.4 16 19,894,891 - 19,895,101 UniSTS RGSC3.4 Celera 16 19,600,705 - 19,600,915 UniSTS RH 3.4 Map 16 238.5 UniSTS Cytogenetic Map 16 p14 UniSTS
RH132898
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 16 19,414,711 - 19,414,919 (+) MAPPER mRatBN7.2 Rnor_6.0 16 21,162,973 - 21,163,180 NCBI Rnor6.0 Rnor_5.0 16 21,078,258 - 21,078,465 UniSTS Rnor5.0 RGSC_v3.4 16 19,897,973 - 19,898,180 UniSTS RGSC3.4 Celera 16 19,603,787 - 19,603,994 UniSTS Cytogenetic Map 16 p14 UniSTS
AW529290
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 16 19,409,722 - 19,409,907 (+) MAPPER mRatBN7.2 Rnor_6.0 16 21,157,984 - 21,158,168 NCBI Rnor6.0 Rnor_5.0 16 21,073,269 - 21,073,453 UniSTS Rnor5.0 RGSC_v3.4 16 19,892,984 - 19,893,168 UniSTS RGSC3.4 Celera 16 19,598,798 - 19,598,982 UniSTS RH 3.4 Map 16 239.42 UniSTS Cytogenetic Map 16 p14 UniSTS
RH138886
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 16 19,409,348 - 19,409,487 (+) MAPPER mRatBN7.2 Rnor_6.0 16 21,157,611 - 21,157,749 NCBI Rnor6.0 Rnor_5.0 16 21,072,896 - 21,073,034 UniSTS Rnor5.0 RGSC_v3.4 16 19,892,611 - 19,892,749 UniSTS RGSC3.4 Celera 16 19,598,425 - 19,598,563 UniSTS RH 3.4 Map 16 216.42 UniSTS Cytogenetic Map 16 p14 UniSTS
BI281824
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 16 19,409,345 - 19,409,495 (+) MAPPER mRatBN7.2 Rnor_6.0 16 21,157,608 - 21,157,757 NCBI Rnor6.0 Rnor_5.0 16 21,072,893 - 21,073,042 UniSTS Rnor5.0 RGSC_v3.4 16 19,892,608 - 19,892,757 UniSTS RGSC3.4 Celera 16 19,598,422 - 19,598,571 UniSTS RH 3.4 Map 16 239.82 UniSTS Cytogenetic Map 16 p14 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000027846 ⟹ ENSRNOP00000027846
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 19,383,492 - 19,408,727 (+) Ensembl Rnor_6.0 Ensembl 16 21,132,147 - 21,163,257 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000084243 ⟹ ENSRNOP00000071129
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 19,383,492 - 19,388,923 (+) Ensembl Rnor_6.0 Ensembl 16 21,132,147 - 21,137,186 (+) Ensembl
RefSeq Acc Id:
NM_001106077 ⟹ NP_001099547
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,448,922 (+) NCBI mRatBN7.2 16 19,383,885 - 19,414,996 (+) NCBI Rnor_6.0 16 21,132,147 - 21,163,257 (+) NCBI Rnor_5.0 16 21,047,433 - 21,078,542 (+) NCBI RGSC_v3.4 16 19,867,097 - 19,895,132 (+) RGD Celera 16 19,572,963 - 19,604,071 (+) NCBI
Sequence:
ATGGCGGCACAAGCGGCGGCTGCGGCGCAGGCGGCGGCGGCAGCACAGGCGGCCGCAGCGCAGGCCGCACAGGCCGAGGCAGCCGAGTCGTGGTATCTGGCTCTCCTGGGTTTCGCCGAGCACTTCCG
hide sequence
RefSeq Acc Id:
NM_001277306 ⟹ NP_001264235
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,422,853 (+) NCBI mRatBN7.2 16 19,383,885 - 19,388,925 (+) NCBI Rnor_6.0 16 21,132,147 - 21,137,188 (+) NCBI Rnor_5.0 16 21,047,433 - 21,078,542 (+) NCBI Celera 16 19,572,963 - 19,578,002 (+) NCBI
Sequence:
ATGGCGGCACAAGCGGCGGCTGCGGCGCAGGCGGCGGCGGCAGCACAGGCGGCCGCAGCGCAGG
hide sequence
RefSeq Acc Id:
XM_006252877 ⟹ XP_006252939
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,448,917 (+) NCBI mRatBN7.2 16 19,383,847 - 19,414,990 (+) NCBI Rnor_6.0 16 21,132,118 - 21,160,179 (+) NCBI Rnor_5.0 16 21,047,433 - 21,078,542 (+) NCBI
Sequence:
GGAGGCGGCTTGTTGTTGTGCAGGCCAAGATGGCGGCACAAGCGGCGGCTGCGGCGCAGGCGGC
hide sequence
RefSeq Acc Id:
XM_063275189 ⟹ XP_063131259
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,438,583 (+) NCBI
RefSeq Acc Id:
XR_005494570
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,439,993 (+) NCBI mRatBN7.2 16 19,383,847 - 19,406,071 (+) NCBI
RefSeq Acc Id:
XR_005494572
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 19,417,812 - 19,439,559 (+) NCBI mRatBN7.2 16 19,383,847 - 19,405,632 (+) NCBI
RefSeq Acc Id:
NP_001099547 ⟸ NM_001106077
- Peptide Label:
isoform 1
- UniProtKB:
D3Z8G8 (UniProtKB/TrEMBL)
- Sequence:
MAAQAAAAAQAAAAAQAAAAQAAQAEAAESWYLALLGFAEHFRTSSPPKIRLCVHCLQAVFPFKPPQRIEARTHLQLGSVLYHHTKNSEQARSHLEKAWLISQQIPQFEDVKFEAASLLSELYCQENS
hide sequence
RefSeq Acc Id:
NP_001264235 ⟸ NM_001277306
- Peptide Label:
isoform 2
- UniProtKB:
A0A0G2JZP5 (UniProtKB/TrEMBL), A6KA97 (UniProtKB/TrEMBL)
- Sequence:
MAAQAAAAAQAAAAAQAAAAQAAQAEAAESWYLALLGFAEHFRTSSPPKIRLCVHCLQAVFPFKPPQRIEARTHLQLGSVLYHHTKNSEQARSHLEKAVPLYAR
hide sequence
RefSeq Acc Id:
XP_006252939 ⟸ XM_006252877
- Peptide Label:
isoform X1
- UniProtKB:
A6KA95 (UniProtKB/TrEMBL), D3Z8G8 (UniProtKB/TrEMBL)
- Sequence:
MAAQAAAAAQAAAAAQAAAAQAAQAEAAESWYLALLGFAEHFRTSSPPKIRLCVHCLQAVFPFKPPQRIEARTHLQLGSVLYHHTKNSEQARSHLEKAWLISQQIPQFEDVKFEAASLLSELYCQENS
hide sequence
Ensembl Acc Id:
ENSRNOP00000027846 ⟸ ENSRNOT00000027846
Ensembl Acc Id:
ENSRNOP00000071129 ⟸ ENSRNOT00000084243
RefSeq Acc Id:
XP_063131259 ⟸ XM_063275189
- Peptide Label:
isoform X2
RGD ID: 13700048 Promoter ID: EPDNEW_R10572 Type: multiple initiation site Name: Mau2_1 Description: MAU2 sister chromatid cohesion factor SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 16 21,132,132 - 21,132,192 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-11-19
Mau2
MAU2 sister chromatid cohesion factor
Mau2
Mau2 chromatid cohesion factor homolog (C. elegans)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2011-05-16
Mau2
Mau2 chromatid cohesion factor homolog (C. elegans)
RGD1308759
similar to KIAA0892 protein
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
RGD1308759
similar to KIAA0892 protein
RGD1308759_predicted
similar to KIAA0892 protein (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-20
RGD1308759_predicted
similar to KIAA0892 protein (predicted)
LOC290668_predicted
Symbol and Name status set to approved
1331353 APPROVED
2005-01-12
LOC290668_predicted
similar to KIAA0892 protein (predicted)
Symbol and Name status set to provisional
70820 PROVISIONAL
