D12Rat65 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D12Rat65

Symbol: D12Rat65
Previously known as: oxsts9364; R0110-C10; 
RGD ID: 39886
Expected Size: 197 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81216,558,044 - 16,558,241 (+)Marker Load Pipeline
mRatBN7.21211,444,466 - 11,444,665 (+)MAPPERmRatBN7.2
Rnor_6.01213,497,899 - 13,498,095NCBIRnor6.0
Rnor_5.01215,538,086 - 15,538,282UniSTSRnor5.0
RGSC_v3.41211,815,987 - 11,816,184RGDRGSC3.4
RGSC_v3.41211,815,988 - 11,816,184UniSTSRGSC3.4
Celera1213,236,425 - 13,236,627UniSTS
RGSC_v3.11211,845,915 - 11,846,112RGD
SHRSP x BN Map1214.81RGD
SHRSP x BN Map1214.81UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WTC/Kyo


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTTCCTCATCCATTTTGCC
Reverse Primer AGCCCTGGGACCAACAAAG
 
Template
GCGACGCGAGAGGATCCCCCCAGAGGGCANNGCATATCAGGCNGCCNGTCAGCNNATNGTTCAG
TGACAGACAAGGTAGGGCGGGGGAGGGCTCNGTGGAATAGAGGTGATNCCTACTAAACCCCAGG
ACNNGAGTNNGAGCCCTGGGACCAACAAAGNNGACAGAGAACCAGCTNCAGGTCCTNNGATCTC
ACGAGTTNNCGCTCCCCCTCGCCCCCTCTCNNGCAGACACACAAACACACACAGACACACACAC
ACANGANANACACACACACACACACACACACGAAATGTNNTAAGGAAAGCGAATAAAAAAGAGG
NGGCAAAATGGATGAGGAAGACACTNGCCAGTGATCTCNGNGCTCTGCTGCGCACGCTTGTGTA
CCCACACATGCACATGNGCNTGAAGTCACACAGAGAGGATGCACAGACGCNGAAAATTTNTAAA
AGAATGNCAGGCGAGGAAAAGTCTCCTGTATNNTAAGAAGCCCATNGAGANAAGAGNNCAGTNT
NGCAGNGGNGGNNNCNGNGNAGGGCGGTCTGGNGNGNNNNNNTNCGGGCGG

Region

Nucleotide Sequences
GenBank Nucleotide CH474012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12592191825247790Rat
70213Niddm27Non-insulin dependent diabetes mellitus QTL 273.72blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121120049452308831Rat
2306789Ean6Experimental allergic neuritis QTL 64.9nervous system integrity trait (VT:0010566)experimental autoimmune neuritis severity score (CMO:0001528)12129775522Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)121120049452308831Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)121120049452308831Rat
1357337Gluco3Glucose level QTL 30.0004adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)12116966671Rat
5684888Pia42Pristane induced arthritis QTL 42joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12348941648489416Rat
1331739Hrtrt14Heart rate QTL 143.56232heart pumping trait (VT:2000009)heart rate (CMO:0000002)12138687564Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)121120049752308831Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)121526424852308831Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)12133700600Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)121174352852308831Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)121120049452308831Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)121186960016966542Rat
61334Gluco17Glucose level QTL 176.3adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)12116966671Rat
2293684Bmd26Bone mineral density QTL 264.40.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)12138635130Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12128133365Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)121223300030490641Rat
1300174Bw15Body weight QTL 152.93body mass (VT:0001259)body weight loss (CMO:0001399)12128606299Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121618743852308831Rat
1331787Rf41Renal function QTL 412.998kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)12133700556Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121613502952308831Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121618743851213550Rat
1331763Wbc2White blood cell count QTL 23.162leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)121120049452308831Rat
7204484Bp358Blood pressure QTL 3580.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12124849755Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)61120049452308831Rat
7387292Kidm42Kidney mass QTL 423.030.0004kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)12141361854Rat
1298081Cia25Collagen induced arthritis QTL 254.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12274769447747694Rat
2303568Bw88Body weight QTL 883body mass (VT:0001259)body weight (CMO:0000012)12128606299Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12308718048087180Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)121120049452308831Rat
7243862Mcs30Mammary carcinoma susceptibility QTL 308.62mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)12563330650633306Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121613502952308831Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12790162533938215Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)121120049452308831Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121618743833700556Rat


Additional Information