D4Rat34 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Rat34

Symbol: D4Rat34
Previously known as: oxsts7069; R019-C01; R0019-C01; 
RGD ID: 35409
Expected Size: 191 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8486,709,649 - 86,709,840 (+)Marker Load Pipeline
mRatBN7.2485,379,421 - 85,379,614 (+)MAPPERmRatBN7.2
Rnor_6.0486,438,317 - 86,438,507NCBIRnor6.0
Rnor_5.04151,090,671 - 151,090,861UniSTSRnor5.0
RGSC_v3.4485,014,031 - 85,014,222RGDRGSC3.4
RGSC_v3.4485,014,032 - 85,014,222UniSTSRGSC3.4
Celera480,234,809 - 80,234,999UniSTS
RGSC_v3.1485,257,503 - 85,257,693RGD
RH 3.4 Map4533.1UniSTS
RH 3.4 Map4533.1RGD
SHRSP x BN Map443.1UniSTS
SHRSP x BN Map443.1RGD
FHH x ACI Map453.55RGD
Cytogenetic Map4q24UniSTS
Is Marker For: Strains:   AVN/Orl ; BBDP/Rhw ; BBDR/Rhw ; GK/KyoSwe ; DA.F344-Aia1/2 ; COP/OlaHsd ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; DA/PitN ; DON/Melb ; F344/Pit ; FHH/Eur ; IS/Kyo ; LE/Mol ; LEW/Pit ; LH/Mav ; MHS/Gib ; MNRA/N ; WN/N ; WKY/OlaHsd ; WTC/Kyo ; LOU/CHan ; MNR/N ; MR/Pit ; ODU/N ; WF/Pit ; WIST/Nhg ; SR/Jr ; MNS/Gib ; NP9 ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SHRSP/Riv ; WAG/RijKyo ; M520/N ; ACI/N ; BN-Lx/Cub ; LN/Mav ; GH/Omr ; NEDH/K ; SS/Jr
QTLs:   Alc18   Bp124   Gluco11   Alc21  
Genes:   Pde1c  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CCCTGTAGTTTAATTCTCCAAATGA
Reverse Primer AAGAGCATAAGCACGTGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
68332Pde1cphosphodiesterase 1C48662907487108147Rat

Nucleotide Sequences
GenBank Nucleotide CH474011 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)486583980149763391Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)439431983123203361Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)459753119104753119Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44442502489425024Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)427730518170099664Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)474233320119233320Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)480212111119233320Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)458817672103817672Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)426234499134199155Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)474233320119233320Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)471647492116647492Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482944895154403548Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)427862204126119996Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)475939858140508796Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)465060960127749483Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)445429897149763204Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)451085655113588029Rat
61364Iddm2Insulin dependent diabetes mellitus QTL 2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)480216705104243248Rat
2317588Eae27Experimental allergic encephalomyelitis QTL 27nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)469036742114036742Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)440490442117737312Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)457613339151163960Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)457613242102613242Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)412212457182430611Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)457613242102613242Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)464084079109084079Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)457613242102613242Rat
2306794Ean2Experimental allergic neuritis QTL 26.4nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)48279077797183061Rat
2306547Iddm38Insulin dependent diabetes mellitus QTL 38blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)468353567113353567Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)460916264184426481Rat
2306545Iddm39Insulin dependent diabetes mellitus QTL 39blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)478687630123687630Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41170660492690519Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)464084079109084079Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)474169813134199155Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)486058928131411333Rat
2312569Pur19Proteinuria QTL 193.40.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)459836842104836842Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)475939858140508796Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)445429897149763204Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)46104105794638356Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45889999148002343Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)460916264174095838Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)484349032129349032Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)445429709157555683Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)463245026129846354Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)464209744109209744Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)460916264184426481Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)486709649168870974Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)457664252127749483Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)482336765127336765Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45807987592690793Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)465495851159259805Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)464084079109084079Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)486583980131583980Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)463224393108224393Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46390045888813920Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)433538597116185060Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302902 UniSTS
  326526 UniSTS
  369149 UniSTS
  554297 UniSTS
  81742 UniSTS