D7Arb6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Arb6

Symbol: D7Arb6
Previously known as: R0267-C11; oxsts7946; 
RGD ID: 42219
Expected Size: 247 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27131,786,607 - 131,786,854 (+)MAPPERmRatBN7.2
Rnor_6.07142,318,944 - 142,319,190NCBIRnor6.0
Rnor_5.07140,123,768 - 140,124,014UniSTSRnor5.0
RGSC_v3.47139,453,061 - 139,453,308RGDRGSC3.4
RGSC_v3.47139,453,062 - 139,453,308UniSTSRGSC3.4
RGSC_v3.17139,529,498 - 139,529,745RGD
Celera7128,262,784 - 128,263,030UniSTS
RH 3.4 Map71070.6UniSTS
RH 3.4 Map71070.6RGD
RH 2.0 Map7794.8RGD
SHRSP x BN Map788.4599RGD
FHH x ACI Map773.51RGD
Cytogenetic Map7q36UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Cela1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TAGTGTCAGAGTGGACAGTGGG
Reverse Primer GAAAGAGTGGATGGGTTCCTGC
 

Region

Nucleotide Sequences
GenBank Nucleotide L00112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
1354582Stl11Serum triglyceride level QTL 113.42blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7119513385135012528Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24331 UniSTS
NCBI Nucleotide J00730
  L00112
UniSTS 122286 UniSTS