| 598092574 | F344-Hspa8em1Opu | | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaa atatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 598092577 | F344-Hspa8em2Opu | | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM style='font-weight:700;'>PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 38599190 | F344-Il2rgem1IexasRag2em1Iexas | | This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 38599189 | F344-Rag2em1Iexas | | This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electro poration. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 14985210 | LE-Cyfip1em1Sage+/- | | The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons , Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. | | mutant | 4 | origin |
| 38599208 | SHR-Prdx2em1Izm | | This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM nt-weight:700;'>PAM sequence:CCT). | National BioResource Project for the Rat in Japan | mutant | 5 | origin |
| 38599206 | SHR-Prdx2em2Izm | | This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene.
Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM t-weight:700;'>PAM sequence:CCT). | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 38676451 | W-Phf24em11Iexas | | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 38676452 | W-Phf24em24Iexas | | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 329845586 | W;WIAR-Izumo1em1Osb | | Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence：TGG. A 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR ba ckground KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
