Gaa Strain Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

10 records found for search term Gaa

Refine Term:

Sort By:

Rat

Export

RGD ID	Symbol	Name	Origin	Source	Type	Annotations	Match
1626214	BN-Slc27a5^m2Mcwi		Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. ... (more) K160E mutation is generated from the codon change AAA/GAA.		mutant	1	origin
150429988	SHR-Tg(EEF1A1-Wars2)Ipcv		This strain was derived by microinjecting fertilized eggs with a mix of the Sleeping Beauty construct containing BN Wars2 cDNA under control of the universal EF-1Î± (human EEF1A1) promoter and mRNA of the SB100X transposase (Ivics et al. 2014). Transgenic rats were detected using PCR with the follow ... (more) ing primers: Wars2-F 5'-TGT GCT ACA AGT CCA CAC AC-3' and Wars2-R 5'-GCA GAA GGG TCA CGA AGA GA-3'.		transgenic	3	origin
1599762	SS-Bdkrb2^m2Mcwi		Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. ... (more) E178V mutation is generated from the codon change GAA/GTA.		mutant	1	origin
617301243	SD-Slc5a10^em1Mcwi		Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted.	Dr. Noreen Rossi, Contact Email: nrossi@wayne.edu	mutant	1	origin
6893600	SS-Abcb1b^em2Mcwi		This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.		mutant	1	origin
5131910	SS-Acad10^em2Mcwi		This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.		mutant	1	origin
6484721	SS-Ace^em1Mcwi		This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6.		mutant	1	origin
6484718	SS-Ace^em2Mcwi		This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6.		mutant	1	origin
617148292	SS-Del(2q)1Mcwi ^+/+		Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi emb ... (more) ryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG).	Please contact: mcwcustomrats@mcw.edu	mutant	1	origin
401938598	SS-Del(2q)1Mcwi ^-/-		Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi emb ... (more) ryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG).	Please contact: mcwcustomrats@mcw.edu	mutant	1	origin