BE119311 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE119311

Symbol: BE119311
Previously known as:
RGD ID: 5082397
Expected Size: 170 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21014,962,011 - 14,962,181 (+)MAPPERmRatBN7.2
Rnor_6.01015,308,977 - 15,309,146NCBIRnor6.0
Rnor_5.01015,121,952 - 15,122,121UniSTSRnor5.0
RGSC_v3.41015,207,720 - 15,207,889UniSTSRGSC3.4
Celera1014,630,856 - 14,631,025UniSTS
RH 3.4 Map10152.1UniSTS
Cytogenetic Map10q12UniSTS
Is Marker For: Genes:   Prr35  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTTTCTAGTCCATGAGACCGCA
Reverse Primer TCTGTTCACAGCCACGGTAGAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1598335Prr35proline rich 35101496195514966818Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10538701450387014Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)10538701450387014Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10124158324Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10637574651375746Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
7387235Uae41Urinary albumin excretion QTL 415.260.1874urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)10129497586Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
737820Alc9Alcohol consumption QTL 92.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10514402719233348Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10538701450387014Rat
631828Alc5Alcohol consumption QTL 52.4consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10514402717245662Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
631660Hcar1Hepatocarcinoma resistance QTL 13.40.0001liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)10615418215990232Rat
1576304Schws7Schwannoma susceptibility QTL 70.0115nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)10476552719816042Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 302999 UniSTS