BE103433 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE103433

Symbol: BE103433
Previously known as:
RGD ID: 5059860
Expected Size: 152 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21951,134,159 - 51,134,311 (+)MAPPERmRatBN7.2
Rnor_6.01955,897,659 - 55,897,810NCBIRnor6.0
Rnor_5.01966,603,417 - 66,603,568UniSTSRnor5.0
RGSC_v3.41953,418,002 - 53,418,153UniSTSRGSC3.4
Celera1950,370,586 - 50,370,737UniSTS
RH 3.4 Map19710.01UniSTS
Cytogenetic Map19q12UniSTS
Is Marker For: Genes:   Spg7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGAGAGAGGGAGAGAGGGAGAG
Reverse Primer TGGTGCACATTATAGTCCGAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
727940Spg7SPG7 matrix AAA peptidase subunit, paraplegin195111708851151228Rat

Nucleotide Sequences
GenBank Nucleotide CH473972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313395Anxrr26Anxiety related response QTL 26aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)194997648153225766Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
5135224Leukc1Leukocyte quantity QTL 1eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)194434021455283277Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 353231 UniSTS