RH133897 Marker Search Result - Rat Genome Database

RH133897 Marker Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

General

Marker: RH133897

Symbol:

RH133897

Previously known as:

AA819484;

RGD ID:

5050162

Expected Size:

196 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	36,850,124 - 36,850,320 (+)	MAPPER	mRatBN7.2
Rnor_6.0	20	38,966,079 - 38,966,274	NCBI	Rnor6.0
Rnor_5.0	20	40,703,894 - 40,704,089	UniSTS	Rnor5.0
RGSC_v3.4	20	36,541,256 - 36,541,451	UniSTS	RGSC3.4
Celera	20	38,164,832 - 38,165,027	UniSTS
RH 3.4 Map	20	392.7	UniSTS
Cytogenetic Map	20	q11	UniSTS

Is Marker For:

Genes: Serinc1

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	TTAACACGGGATAAGGTTGGAAA
Reverse Primer	AATGTTTGTTTACTGCCATGCAA

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
727843	Serinc1	serine incorporator 1	20	36850062	36868999	Rat


RefSeq Transcripts	NM_182951	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AY339894	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC088852	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ212594	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ213445	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ214185	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ229961	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4889610	Pancm3	Pancreatic morphology QTL 3	3.75	0.001	pancreas mass (VT:0010144)	pancreas wet weight (CMO:0000626)	20	17617832	47606836	Rat
2303587	Bw93	Body weight QTL 93	13		body mass (VT:0001259)	body weight (CMO:0000012)	20	25106722	54435887	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
2303626	Vencon10	Ventilatory control QTL 10		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	20	19190721	54435887	Rat
1598869	Memor6	Memory QTL 6	3.1		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	20	29244388	54435887	Rat
70158	Bp60	Blood pressure QTL 60	3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	20	31614284	44396023	Rat
7411652	Foco24	Food consumption QTL 24		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	11757515	54435887	Rat
1331747	Hrtrt16	Heart rate QTL 16	3.163		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	20	25209734	54435887	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
2303578	Gluco50	Glucose level QTL 50	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	20	25106722	54435887	Rat
2317880	Alcrsp25	Alcohol response QTL 25	2.3		response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	17697550	54435887	Rat
9590092	Insglur9	Insulin/glucose ratio QTL 9	18.38	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	20	11757515	54435887	Rat
2300188	Bmd68	Bone mineral density QTL 68	6.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	20	25106722	54435887	Rat

Database	Acc Id	Source(s)
NCBI Gene	294421	UniSTS