Marker: RH132628 |
| Symbol: |
RH132628 |
| Previously known as: |
AI556095;
|
| RGD ID: |
5047960 |
| Expected Size: |
215 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 7 | 9,392,338 - 9,392,657 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 7 | 9,392,338 - 9,392,785 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 7 | 12,258,471 - 12,258,917 | NCBI | Rnor6.0 | Rnor_6.0 | 7 | 12,258,471 - 12,258,789 | NCBI | Rnor6.0 | Rnor_5.0 | 7 | 12,428,266 - 12,428,712 | UniSTS | Rnor5.0 | Rnor_5.0 | 7 | 12,428,266 - 12,428,584 | UniSTS | Rnor5.0 | RGSC_v3.4 | 7 | 10,903,678 - 10,904,124 | UniSTS | RGSC3.4 | RGSC_v3.4 | 7 | 10,903,678 - 10,903,996 | UniSTS | RGSC3.4 | Celera | 7 | 7,569,132 - 7,569,450 | UniSTS | | Celera | 7 | 7,569,132 - 7,569,578 | UniSTS | | Cytogenetic Map | 7 | q11 | UniSTS | |
|
| Is Marker For: |
Genes:
Apc2
C7h19orf25
|
Annotation
Strains and Sequence
Sequence
| |
| Forward Primer |
AGCCAAATGTCCCGCTTTATTA |
| Reverse Primer |
CACTCTGCACCCTGATTTAGTG |
| |
Region
Genes in Region
| 1359127 | C7h19orf25 | similar to human chromosome 19 open reading frame 25 | 7 | 9390255 | 9392383 | Rat | | 1308256 | Apc2 | APC regulator of WNT signaling pathway 2 | 7 | 9392336 | 9414364 | Rat | |
QTLs in Region (mRatBN7.2)
| 61410 | Bw19 | Body weight QTL 19 | 6.2 | 0.001 | body mass (VT:0001259) | body weight (CMO:0000012) | 7 | 1 | 44782185 | Rat | | 1300176 | Hrtrt10 | Heart rate QTL 10 | 3.19 | | heart pumping trait (VT:2000009) | heart rate (CMO:0000002) | 7 | 664270 | 26029351 | Rat | | 9590102 | Sffal5 | Serum free fatty acids level QTL 5 | 8.62 | 0.001 | blood free fatty acid amount (VT:0001553) | plasma free fatty acids level (CMO:0000546) | 7 | 5329019 | 50329019 | Rat | | 631503 | Bp102 | Blood pressure QTL 102 | 1.9 | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 7 | 1 | 44822433 | Rat | | 634336 | Anxrr17 | Anxiety related response QTL 17 | 3.66 | | locomotor behavior trait (VT:0001392) | number of entries into a discrete space in an experimental apparatus (CMO:0000960) | 7 | 924703 | 115097879 | Rat | | 10755438 | Coatc9 | Coat color QTL 9 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 3529280 | 48529280 | Rat | | 9590142 | Scort5 | Serum corticosterone level QTL 5 | 24.4 | 0.001 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 7 | 1 | 31962314 | Rat | | 10059592 | Kidm45 | Kidney mass QTL 45 | 3.95 | 0.025 | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 7 | 7573985 | 52573985 | Rat | | 2317047 | Wbc4 | White blood cell count QTL 4 | | 0.01 | leukocyte quantity (VT:0000217) | white blood cell count (CMO:0000027) | 7 | 1 | 35342956 | Rat | | 10755440 | Coatc10 | Coat color QTL 10 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 7496499 | 52496499 | Rat | | 2298550 | Neuinf6 | Neuroinflammation QTL 6 | 3.3 | | nervous system integrity trait (VT:0010566) | spinal cord RT1-B protein level (CMO:0002132) | 7 | 1 | 27829089 | Rat | | 724560 | Plsm3 | Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 | | 0.0003 | tibia length (VT:0004357) | tibia length (CMO:0000450) | 7 | 1 | 34000259 | Rat | | 7411566 | Bw136 | Body weight QTL 136 | 10.4 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 7 | 1 | 31962314 | Rat | |
