RH128388 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128388

Symbol: RH128388
Previously known as: AA899721; 
RGD ID: 5025456
Expected Size: 196 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26103,618,160 - 103,618,356 (+)MAPPERmRatBN7.2
Rnor_6.06107,467,081 - 107,467,276NCBIRnor6.0
Rnor_5.06118,076,869 - 118,077,064UniSTSRnor5.0
RGSC_v3.46108,023,987 - 108,024,182UniSTSRGSC3.4
Celera6101,448,171 - 101,448,366UniSTS
RH 3.4 Map6733.1UniSTS
Cytogenetic Map6q31UniSTS
Is Marker For: Genes:   Acot2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGACAATCTCAAGCTGTCAGGC
Reverse Primer AGTGCCTGTGAGAGACTGAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621055Acot2acyl-CoA thioesterase 26103611738103619404Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 192272 UniSTS