px-45f3 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: px-45f3

Symbol: px-45f3
Previously known as:
RGD ID: 4969377
Expected Size: 244 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map3G1UniSTS
Cytogenetic Map10D1UniSTS
Cytogenetic Map8D3UniSTS
Cytogenetic Map16A3UniSTS
Cytogenetic Map15A1UniSTS
Cytogenetic Map3F2.2UniSTS
Cytogenetic Map7CUniSTS
Cytogenetic Map3DUniSTS
Cytogenetic Map9E3.1UniSTS
cM Map316.4UniSTS
cM Map1354.0UniSTS
Is Marker For: Genes:   Slc7a11   Ranbp3l   Fgd4   4930533N22Rik   6530403H02Rik   D430004P15Rik   Hsd3b2   Ces2b   Cyb5r4  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGTACAACCACTATGGAAA
Reverse Primer GTATCCATTGTGTAAATGTACC
 

Region

Nucleotide Sequences
GenBank Nucleotide AB018705 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC002315 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC002406 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003018 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003019 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003994 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003995 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003996 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC003997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC004096 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC004101 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC004399 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC004405 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC004407 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005403 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005413 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005665 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005743 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005818 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005938 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC005992 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC006056 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC006508 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC006584 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC006943 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC007049 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC007665 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC008160 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC009287 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC012104 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC012147 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC012302 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC020967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC026387 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AE000663 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AE000664 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AE000665 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF007574 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF016099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF021335 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF037352 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF049850 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF050157 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF055466 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081104 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081105 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081106 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081109 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081110 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081111 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081113 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF081114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF091216 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF093878 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF107342 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF131205 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF131931 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF132039 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF146793 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176211 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176212 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176213 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176214 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176216 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176217 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176218 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176219 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176220 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176221 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176222 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF176223 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF240527 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF242431 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF242432 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF242434 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF242435 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF259071 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF259072 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF259073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF259074 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ249895 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ251154 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL021127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL078630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP001288 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY053455 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY053456 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC040397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV079329 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D84391 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  K01734 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M13002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M23236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M29324 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M33580 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63707 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M68842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U15647 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U78038 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X14061 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X52046 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X55036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60028 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z13985 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100042497 UniSTS
  15493 UniSTS
  223332 UniSTS
  224014 UniSTS
  234669 UniSTS
  26570 UniSTS
  266690 UniSTS
  320739 UniSTS
  654439 UniSTS
  75205 UniSTS