Marker: DXGot30 |
| Symbol: |
DXGot30 |
| Previously known as: |
oxsts421; OT38.10;
|
| RGD ID: |
45737 |
| Expected Size: |
179 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
| mRatBN7.2 | X | 35,316,107 - 35,316,288 (+) | MAPPER | mRatBN7.2 | | mRatBN7.2 | X | 35,312,202 - 35,312,381 (+) | MAPPER | mRatBN7.2 | | Rnor_6.0 | X | 38,344,650 - 38,344,828 | NCBI | Rnor6.0 | | Rnor_5.0 | X | 38,653,574 - 38,653,752 | UniSTS | Rnor5.0 | | RGSC_v3.4 | X | 56,516,285 - 56,516,451 | UniSTS | RGSC3.4 | | RGSC_v3.4 | X | 56,516,284 - 56,516,451 | RGD | RGSC3.4 | | RGSC_v3.4 | X | 56,514,856 - 56,515,035 | RGD | RGSC3.4 | | RGSC_v3.4 | X | 56,514,857 - 56,515,035 | UniSTS | RGSC3.4 | | RGSC_v3.1 | X | 56,569,754 - 56,569,920 | RGD | | | Celera | X | 35,973,271 - 35,973,449 | UniSTS | | | RH 3.4 Map | X | 511.6 | UniSTS | | | RH 3.4 Map | X | 511.6 | RGD | | | RH 2.0 Map | 21 | 407.3 | RGD | | | Cytogenetic Map | X | q21 | UniSTS | |
|
| Is Marker For: |
Genes:
Bclaf3
|
Annotation
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
| 3. |
UniSTS Pipeline |
RGD automated pipelines
|
| 4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
| |
| Forward Primer |
TGTTAACCAGCCTTCCAGGT |
| Reverse Primer |
AAGTAGGTTGGAAACAGCATGAT |
| |
| 1562161 | Bclaf3 | BCLAF1 and THRAP3 family member 3 | X | 35257228 | 35328883 | Rat |
| 1598873 | Memor2 | Memory QTL 2 | 2.5 | | exploratory behavior trait (VT:0010471) | average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) | X | 20990947 | 41052531 | Rat | | 1298071 | Edpm12 | Estrogen-dependent pituitary mass QTL 12 | 3.2 | | pituitary gland mass (VT:0010496) | pituitary gland wet weight (CMO:0000853) | X | 2927898 | 47927898 | Rat | | 2290375 | Gluco34 | Glucose level QTL 34 | 2.75 | | blood glucose amount (VT:0000188) | blood glucose level area under curve (AUC) (CMO:0000350) | X | 20990947 | 41203591 | Rat | | 731181 | Uae27 | Urinary albumin excretion QTL 27 | 2.7 | 0.0059 | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | X | 1 | 43491017 | Rat | | 61430 | Cia18 | Collagen induced arthritis QTL 18 | 3.1 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | X | 14843113 | 120568734 | Rat | | 10755455 | Coatc13 | Coat color QTL 13 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 4406000 | 49406000 | Rat | | 631666 | Iddm5 | Insulin dependent diabetes mellitus QTL 5 | | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 4494549 | 49494549 | Rat | | 71116 | Niddm16 | Non-insulin dependent diabetes mellitus QTL 16 | 7.81 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 15297802 | 60297802 | Rat |
|
|
