D10Got124 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Got124

Symbol: D10Got124
Previously known as: oxsts682; OT28.26; 
RGD ID: 44808
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21085,565,469 - 85,565,619 (+)MAPPERmRatBN7.2
mRatBN7.21085,565,469 - 85,565,684 (+)MAPPERmRatBN7.2
Rnor_6.01088,544,136 - 88,544,394NCBIRnor6.0
Rnor_6.01088,544,136 - 88,544,285NCBIRnor6.0
Rnor_5.01088,338,460 - 88,338,609UniSTSRnor5.0
Rnor_5.01088,338,460 - 88,338,718UniSTSRnor5.0
RGSC_v3.41089,575,060 - 89,575,209UniSTSRGSC3.4
RGSC_v3.41089,575,059 - 89,575,209RGDRGSC3.4
RGSC_v3.11089,589,430 - 89,589,579RGD
Celera1084,281,700 - 84,281,849UniSTS
RH 3.4 Map10838.5UniSTS
RH 3.4 Map10838.5RGD
RH 2.0 Map10966.6RGD
Cytogenetic Map10q32.1UniSTS
Is Marker For: Strains:   WF.WKY-(D10Got124-D10Rat187)/Uwm  
QTLs:   Mcs15  
Genes:   Zfp385c  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCCCATGAGCACTCAGACA
Reverse Primer CTCCTGACAGTGCTGGGATTA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU027219 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303056 UniSTS
  303537 UniSTS