D8Got145 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D8Got145

Symbol: D8Got145
Previously known as: oxsts2527; OT87.14; 
RGD ID: 44491
Expected Size: 179 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2887,042,935 - 87,043,114 (+)MAPPERmRatBN7.2
Rnor_6.0893,745,984 - 93,746,162NCBIRnor6.0
Rnor_5.0893,260,882 - 93,261,060UniSTSRnor5.0
RGSC_v3.4891,329,688 - 91,329,867RGDRGSC3.4
RGSC_v3.4891,329,689 - 91,329,867UniSTSRGSC3.4
RGSC_v3.1891,349,144 - 91,349,322RGD
Celera886,648,616 - 86,648,794UniSTS
RH 3.4 Map8997.9UniSTS
RH 3.4 Map8997.9RGD
RH 2.0 Map8793.4RGD
Is Marker For: Strains:   DA.PVG.1AV1-(D8Rat146-D8Got145)   DA.PVG.1AV1-(D8Rat24-D8Got145)  




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer CCATCAACCCTCTGGAAAAA
Reverse Primer CTAAGAGCATCAAAGTGCTTACACA
 
GenBank Nucleotide AU025774 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 42 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)84329616998968765Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)854259986100382532Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)873473045118473045Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)83018886794457446Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)84329616998968765Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)84329616998968765Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)84329616998968765Rat

1 to 10 of 42 rows