D4Wox12 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Wox12

Symbol: D4Wox12
Previously known as: oxsts4969; R252; RNIAPP12; IAPP; 
RGD ID: 10752
Expected Size: 143 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr84176,967,224 - 176,967,367 (+)Marker Load Pipeline
mRatBN7.24175,236,234 - 175,236,377 (+)MAPPERmRatBN7.2
Rnor_6.04176,509,765 - 176,509,907NCBIRnor6.0
Rnor_5.04240,723,308 - 240,723,450UniSTSRnor5.0
RGSC_v3.44179,854,700 - 179,854,843RGDRGSC3.4
RGSC_v3.44179,854,701 - 179,854,843UniSTSRGSC3.4
RGSC_v3.14180,099,824 - 180,099,967RGD
Celera4163,769,128 - 163,769,270UniSTS
RH 3.4 Map41030.7UniSTS
RH 3.4 Map41030.7RGD
RH 2.0 Map41058.1RGD
Cytogenetic Map4q44UniSTS
Is Marker For: QTLs:   Cia24  
Genes:   Iapp  




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer CAGTCCTTGTCTTCAGGTCTCT
Reverse Primer ATACATAGGCACACATGGTTTG
 


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
70985Slco1a5solute carrier organic anion transporter family, member 1A54175172390175254598Rat
GenBank Nucleotide AU026828 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X52820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 17 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4146565735175236377Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat

1 to 10 of 17 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 24476 UniSTS
  387416 UniSTS
NCBI Nucleotide X52820