Symbol:
Rnase1
Name:
ribonuclease A family member 1, pancreatic
RGD ID:
3574
Description:
Predicted to enable RNA nuclease activity. Predicted to be involved in defense response to Gram-positive bacterium. Predicted to act upstream of or within response to bacterium. Predicted to be located in cytosol and lysosomal lumen. Orthologous to human RNASE1 (ribonuclease A family member 1, pancreatic); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 3H-1,2-dithiole-3-thione.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC103690354; pancreatic ribonuclease; Rib1; ribonuclease 1 pancreatic; ribonuclease 1, pancreatic; ribonuclease pancreatic beta-type; ribonuclease RNase A family 1; ribonuclease, RNase A family, 1; ribonuclease, RNase A family, 1 (pancreatic); RL1; RNase 1 gamma; RNase A
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
RNASE1 (ribonuclease A family member 1, pancreatic)
HGNC
Ensembl, HomoloGene, NCBI, OrthoDB, Panther, PhylomeDB
Mus musculus (house mouse):
Rnase1 (ribonuclease, RNase A family, 1 (pancreatic))
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
RNASE1 (ribonuclease A family member 1, pancreatic)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
LOC475395 (ribonuclease pancreatic-like)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Rnase1 (ribonuclease A family member 1, pancreatic)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
RNASE1 (ribonuclease A family member 1, pancreatic)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
LOC103231361 (ribonuclease pancreatic)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Rnase1 (ribonuclease, RNase A family, 1 (pancreatic))
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
RNASE1 (ribonuclease A family member 1, pancreatic)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
rnasel4 (ribonuclease like 4)
Alliance
DIOPT (OrthoFinder|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
rnasel2 (ribonuclease like 2)
Alliance
DIOPT (Hieranoid|OMA|OrthoFinder|PANTHER)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 26,835,436 - 26,837,145 (-) NCBI GRCr8 mRatBN7.2 15 24,361,924 - 24,363,633 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 24,361,927 - 24,363,624 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 27,133,082 - 27,134,791 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 28,092,239 - 28,093,948 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 26,341,641 - 26,343,350 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 28,073,963 - 28,075,677 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 28,074,953 - 28,075,411 (+) NCBI Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 31,897,124 - 31,898,675 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 27,123,440 - 27,124,991 NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 27,139,139 - 27,140,691 NCBI Celera 15 24,679,524 - 24,681,067 (-) NCBI Celera Cytogenetic Map 15 p14 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rnase1 Rat 1,2-dichloroethane increases expression ISO Rnase1 (Mus musculus) 6480464 ethylene dichloride results in increased expression of RNASE1 mRNA CTD PMID:28960355 Rnase1 Rat 1,2-dimethylhydrazine affects expression ISO Rnase1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of RNASE1 mRNA CTD PMID:22206623 Rnase1 Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of RNASE1 mRNA CTD PMID:32145629 Rnase1 Rat 17beta-estradiol multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of RNASE1 mRNA CTD PMID:32741896 Rnase1 Rat 17beta-estradiol 3-benzoate multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of RNASE1 mRNA CTD PMID:32741896 Rnase1 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO RNASE1 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Rnase1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Rnase1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of RNASE1 mRNA CTD PMID:26377647 Rnase1 Rat 2,4,6-tribromophenol decreases expression ISO RNASE1 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Rnase1 Rat 2,4,6-trinitrobenzenesulfonic acid increases expression ISO Rnase1 (Mus musculus) 6480464 Trinitrobenzenesulfonic Acid results in increased expression of RNASE1 mRNA CTD PMID:17982090 Rnase1 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO RNASE1 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of RNASE1 mRNA and tetrabromobisphenol A results in decreased expression of RNASE1 protein CTD PMID:31675489 and PMID:33476716 Rnase1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Rnase1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of RNASE1 mRNA CTD PMID:20188158 Rnase1 Rat 3H-1,2-dithiole-3-thione increases expression EXP 6480464 1 and 2-dithiol-3-thione results in increased expression of RNASE1 mRNA CTD PMID:19162173 Rnase1 Rat acetylsalicylic acid increases expression ISO RNASE1 (Homo sapiens) 6480464 Aspirin results in increased expression of RNASE1 mRNA CTD PMID:11906190 Rnase1 Rat aflatoxin B1 increases methylation ISO RNASE1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of RNASE1 gene CTD PMID:27153756 Rnase1 Rat all-trans-retinoic acid decreases expression ISO Rnase1 (Mus musculus) 6480464 Tretinoin results in decreased expression of RNASE1 mRNA CTD PMID:16604517 Rnase1 Rat all-trans-retinoic acid increases expression ISO RNASE1 (Homo sapiens) 6480464 Tretinoin results in increased expression of RNASE1 mRNA CTD PMID:23830798 Rnase1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of RNASE1 mRNA CTD PMID:16483693 Rnase1 Rat atrazine increases expression ISO RNASE1 (Homo sapiens) 6480464 Atrazine results in increased expression of RNASE1 mRNA CTD PMID:22378314 Rnase1 Rat benzo[a]pyrene increases methylation ISO RNASE1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of RNASE1 exon CTD PMID:27901495 Rnase1 Rat benzo[a]pyrene decreases methylation ISO RNASE1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of RNASE1 5' UTR CTD PMID:27901495 Rnase1 Rat benzo[a]pyrene affects methylation ISO RNASE1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of RNASE1 3' UTR and Benzo(a)pyrene affects the methylation of RNASE1 promoter CTD PMID:27901495 Rnase1 Rat bexarotene increases expression EXP 6480464 Bexarotene results in increased expression of RNASE1 mRNA CTD PMID:16648578 Rnase1 Rat bisphenol A decreases expression ISO RNASE1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of RNASE1 protein CTD PMID:31675489 Rnase1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of RNASE1 mRNA CTD PMID:25181051 and PMID:32145629 Rnase1 Rat butanal increases expression ISO RNASE1 (Homo sapiens) 6480464 butyraldehyde results in increased expression of RNASE1 mRNA CTD PMID:26079696 Rnase1 Rat cadmium dichloride increases expression ISO RNASE1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of RNASE1 mRNA CTD PMID:38568856 Rnase1 Rat calcitriol decreases expression ISO RNASE1 (Homo sapiens) 6480464 Calcitriol results in decreased expression of RNASE1 mRNA CTD PMID:26485663 Rnase1 Rat carbamazepine affects expression ISO RNASE1 (Homo sapiens) 6480464 Carbamazepine affects the expression of RNASE1 mRNA CTD PMID:25979313 Rnase1 Rat carbon nanotube affects expression ISO Rnase1 (Mus musculus) 6480464 Nanotubes and Carbon affects the expression of RNASE1 mRNA CTD PMID:25620056 Rnase1 Rat carbon nanotube decreases expression ISO Rnase1 (Mus musculus) 6480464 Nanotubes and Carbon analog results in decreased expression of RNASE1 mRNA CTD PMID:25620056 Rnase1 Rat CGP 52608 multiple interactions ISO RNASE1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to RNASE1 gene] CTD PMID:28238834 Rnase1 Rat ciguatoxin CTX1B affects expression ISO Rnase1 (Mus musculus) 6480464 Ciguatoxins affects the expression of RNASE1 mRNA CTD PMID:18353800 Rnase1 Rat clofibrate multiple interactions ISO Rnase1 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of RNASE1 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of RNASE1 mRNA] CTD PMID:17585979 Rnase1 Rat decabromodiphenyl ether decreases expression ISO RNASE1 (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of RNASE1 protein CTD PMID:31675489 Rnase1 Rat dorsomorphin multiple interactions ISO RNASE1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNASE1 mRNA CTD PMID:27188386 Rnase1 Rat doxorubicin decreases expression ISO RNASE1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of RNASE1 mRNA CTD PMID:29803840 Rnase1 Rat lead diacetate increases expression ISO Rnase1 (Mus musculus) 6480464 lead acetate results in increased expression of RNASE1 mRNA CTD PMID:20542052 Rnase1 Rat medroxyprogesterone acetate increases expression ISO RNASE1 (Homo sapiens) 6480464 Medroxyprogesterone Acetate results in increased expression of RNASE1 mRNA CTD PMID:20843944 Rnase1 Rat Muraglitazar decreases expression EXP 6480464 muraglitazar results in decreased expression of RNASE1 mRNA CTD PMID:21515302 Rnase1 Rat N-methyl-N-nitrosourea increases expression ISO Rnase1 (Mus musculus) 6480464 Methylnitrosourea results in increased expression of RNASE1 mRNA CTD PMID:15240709 Rnase1 Rat paracetamol multiple interactions ISO Rnase1 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of RNASE1 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of RNASE1 mRNA] CTD PMID:17585979 Rnase1 Rat pentanal increases expression ISO RNASE1 (Homo sapiens) 6480464 pentanal results in increased expression of RNASE1 mRNA CTD PMID:26079696 Rnase1 Rat phenylmercury acetate increases expression ISO RNASE1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of RNASE1 mRNA CTD PMID:26272509 Rnase1 Rat phenylmercury acetate multiple interactions ISO RNASE1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNASE1 mRNA CTD PMID:27188386 Rnase1 Rat pirinixic acid multiple interactions ISO RNASE1 (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of RNASE1 mRNA CTD PMID:19710929 Rnase1 Rat pirinixic acid increases expression ISO Rnase1 (Mus musculus) 6480464 pirinixic acid results in increased expression of RNASE1 mRNA CTD PMID:17426115 Rnase1 Rat SB 431542 multiple interactions ISO RNASE1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNASE1 mRNA CTD PMID:27188386 Rnase1 Rat serpentine asbestos decreases expression ISO RNASE1 (Homo sapiens) 6480464 Asbestos and Serpentine results in decreased expression of RNASE1 mRNA CTD PMID:21148743 Rnase1 Rat silicon dioxide decreases expression ISO RNASE1 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of RNASE1 mRNA CTD PMID:25895662 Rnase1 Rat silver atom increases expression ISO Rnase1 (Mus musculus) 6480464 Silver results in increased expression of RNASE1 mRNA CTD PMID:27131904 Rnase1 Rat silver(0) increases expression ISO Rnase1 (Mus musculus) 6480464 Silver results in increased expression of RNASE1 mRNA CTD PMID:27131904 Rnase1 Rat sodium dichromate decreases expression EXP 6480464 sodium bichromate results in decreased expression of RNASE1 mRNA CTD PMID:22561333 Rnase1 Rat sodium dichromate decreases expression ISO RNASE1 (Homo sapiens) 6480464 sodium bichromate results in decreased expression of RNASE1 mRNA CTD PMID:17685462 Rnase1 Rat succimer multiple interactions ISO Rnase1 (Mus musculus) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in increased expression of RNASE1 mRNA CTD PMID:26378955 Rnase1 Rat sulindac decreases expression ISO RNASE1 (Homo sapiens) 6480464 Sulindac results in decreased expression of RNASE1 mRNA CTD PMID:11906190 Rnase1 Rat Tesaglitazar decreases expression EXP 6480464 tesaglitazar results in decreased expression of RNASE1 mRNA CTD PMID:21515302 Rnase1 Rat testosterone multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of RNASE1 mRNA CTD PMID:32741896 Rnase1 Rat testosterone decreases expression ISO Rnase1 (Mus musculus) 6480464 Testosterone deficiency results in decreased expression of RNASE1 mRNA CTD PMID:33848595 Rnase1 Rat triclosan decreases expression ISO RNASE1 (Homo sapiens) 6480464 Triclosan results in decreased expression of RNASE1 mRNA CTD PMID:30510588 Rnase1 Rat troglitazone decreases expression EXP 6480464 Troglitazone results in decreased expression of RNASE1 mRNA CTD PMID:21515302 Rnase1 Rat valproic acid increases expression ISO RNASE1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of RNASE1 mRNA CTD PMID:28001369 Rnase1 Rat valproic acid decreases expression ISO RNASE1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of RNASE1 mRNA CTD PMID:29154799 Rnase1 Rat valproic acid affects expression ISO RNASE1 (Homo sapiens) 6480464 Valproic Acid affects the expression of RNASE1 mRNA CTD PMID:25979313 Rnase1 Rat valproic acid increases methylation ISO RNASE1 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of RNASE1 gene CTD PMID:29154799
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (EXP) 17beta-estradiol 3-benzoate (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4,6-tribromophenol (ISO) 2,4,6-trinitrobenzenesulfonic acid (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3H-1,2-dithiole-3-thione (EXP) acetylsalicylic acid (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) ammonium chloride (EXP) atrazine (ISO) benzo[a]pyrene (ISO) bexarotene (EXP) bisphenol A (EXP,ISO) butanal (ISO) cadmium dichloride (ISO) calcitriol (ISO) carbamazepine (ISO) carbon nanotube (ISO) CGP 52608 (ISO) ciguatoxin CTX1B (ISO) clofibrate (ISO) decabromodiphenyl ether (ISO) dorsomorphin (ISO) doxorubicin (ISO) lead diacetate (ISO) medroxyprogesterone acetate (ISO) Muraglitazar (EXP) N-methyl-N-nitrosourea (ISO) paracetamol (ISO) pentanal (ISO) phenylmercury acetate (ISO) pirinixic acid (ISO) SB 431542 (ISO) serpentine asbestos (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sodium dichromate (EXP,ISO) succimer (ISO) sulindac (ISO) Tesaglitazar (EXP) testosterone (EXP,ISO) triclosan (ISO) troglitazone (EXP) valproic acid (ISO)
Rnase1 (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 26,835,436 - 26,837,145 (-) NCBI GRCr8 mRatBN7.2 15 24,361,924 - 24,363,633 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 24,361,927 - 24,363,624 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 27,133,082 - 27,134,791 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 28,092,239 - 28,093,948 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 26,341,641 - 26,343,350 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 28,073,963 - 28,075,677 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 28,074,953 - 28,075,411 (+) NCBI Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 31,897,124 - 31,898,675 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 27,123,440 - 27,124,991 NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 27,139,139 - 27,140,691 NCBI Celera 15 24,679,524 - 24,681,067 (-) NCBI Celera Cytogenetic Map 15 p14 NCBI
RNASE1 (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 14 20,801,228 - 20,802,844 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 14 20,801,228 - 20,802,855 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 14 21,269,387 - 21,271,003 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 14 20,339,355 - 20,340,876 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 14 20,339,355 - 20,340,876 NCBI Celera 14 1,130,381 - 1,131,902 (-) NCBI Celera Cytogenetic Map 14 q11.2 NCBI HuRef 14 1,390,522 - 1,392,043 (-) NCBI HuRef CHM1_1 14 21,271,658 - 21,273,179 (-) NCBI CHM1_1 T2T-CHM13v2.0 14 14,998,670 - 15,000,286 (-) NCBI T2T-CHM13v2.0
Rnase1 (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 51,382,459 - 51,384,224 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 51,382,455 - 51,384,242 (-) Ensembl GRCm39 Ensembl GRCm38 14 51,145,002 - 51,146,767 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 51,144,998 - 51,146,785 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 51,764,677 - 51,766,442 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 50,066,953 - 50,068,718 (-) NCBI MGSCv36 mm8 Celera 14 47,439,042 - 47,440,804 (-) NCBI Celera Cytogenetic Map 14 C1 NCBI cM Map 14 26.4 NCBI
RNASE1 (Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 15 22,298,976 - 22,300,905 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 14 21,515,463 - 21,517,392 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 14 1,663,595 - 1,665,121 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 14 19,719,885 - 19,746,621 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 14 19,720,127 - 19,720,597 (-) Ensembl panpan1.1 panPan2
LOC475395 (Canis lupus familiaris - dog)
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 15 18,034,337 - 18,065,925 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 15 18,037,298 - 18,066,333 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 15 18,522,914 - 18,524,349 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 15 18,281,909 - 18,326,869 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 15 18,298,180 - 18,299,615 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 15 17,979,542 - 17,980,977 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 15 18,035,593 - 18,037,028 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 15 18,163,424 - 18,164,859 (-) NCBI UU_Cfam_GSD_1.0
Rnase1 (Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
RNASE1 (Sus scrofa - pig)
LOC103231361 (Chlorocebus sabaeus - green monkey)
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 29 21,312,858 - 21,314,712 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 29 21,313,095 - 21,313,553 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 25,116,644 - 25,118,609 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
.
Predicted Target Of
Count of predictions: 34 Count of miRNA genes: 32 Interacting mature miRNAs: 33 Transcripts: ENSRNOT00000041822 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1331729 Rf42 Renal function QTL 42 3.071 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 15 17362897 73690657 Rat 1641887 Alcrsp14 Alcohol response QTL 14 response to alcohol trait (VT:0010489) brain neurotensin receptor 1 density (CMO:0002068) 15 1 42356671 Rat 10755503 Bp391 Blood pressure QTL 391 2.37 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 15 20248600 37896129 Rat 1578646 Bmd18 Bone mineral density QTL 18 5.2 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 15 22806240 98288169 Rat 9589149 Insul29 Insulin level QTL 29 9.06 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 15 1 34723002 Rat 1578647 Bmd17 Bone mineral density QTL 17 4 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 15 22806240 98288169 Rat 10401805 Kidm51 Kidney mass QTL 51 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 15 306329 45306329 Rat 2317750 Glom26 Glomerulus QTL 26 4.3 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 15 12496141 65205939 Rat 2298549 Neuinf12 Neuroinflammation QTL 12 3.5 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 15 1 55302115 Rat 8552920 Pigfal8 Plasma insulin-like growth factor 1 level QTL 8 3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 15 1 34723002 Rat 2293688 Bss29 Bone structure and strength QTL 29 5.31 0.0001 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 15 11111142 56111142 Rat 5685002 Bss103 Bone structure and strength QTL 103 2.8 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 15 14481165 28469888 Rat 8694361 Abfw6 Abdominal fat weight QTL 6 10.2 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 15 1 34723002 Rat 631273 Lecl2 Lens clarity QTL 2 0.001 lens clarity trait (VT:0001304) age of onset/diagnosis of cataract (CMO:0001584) 15 10596089 55596089 Rat 2300167 Bmd63 Bone mineral density QTL 63 5.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 15 11111142 56111142 Rat 731170 Pur3 Proteinuria QTL 3 2.3 0.0005 urine protein amount (VT:0005160) urine protein excretion rate (CMO:0000759) 15 1 41686771 Rat 738017 Hcas7 Hepatocarcinoma susceptibility QTL 7 2.91 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 15 2266368 46921453 Rat 10054130 Srcrt8 Stress Responsive Cort QTL 8 2.18 0.0085 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 15 22117933 67117933 Rat 2300173 Bmd62 Bone mineral density QTL 62 12.8 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 15 11111142 56111142 Rat 2324620 Coatc3 Coat color QTL 3 coat/hair pigmentation trait (VT:0010463) pigmented coat/hair area to total coat/hair area ratio (CMO:0001810) 15 19856566 46187442 Rat 61424 Scl1 Serum cholesterol level QTL 1 7.7 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 15 16725528 80672115 Rat 1582251 Gluco24 Glucose level QTL 24 3.2 0.0008 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 15 5530756 50530756 Rat 1354657 Despr13 Despair related QTL 13 0.0022 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 15 1 29912054 Rat 631550 Bw7 Body weight QTL 7 3.6 body mass (VT:0001259) body weight (CMO:0000012) 15 19856566 34924750 Rat 1578660 Bss19 Bone structure and strength QTL 19 4.3 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 15 22806240 98288169 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
3
6
10
23
25
14
6
14
6
38
15
2
6
7
11
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000082938 ⟹ ENSRNOP00000072263
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 24,361,927 - 24,363,624 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000086427 ⟹ ENSRNOP00000068653
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 15 28,074,953 - 28,075,411 (+) Ensembl
RefSeq Acc Id:
NM_001029904 ⟹ NP_001025075
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 26,835,436 - 26,837,145 (-) NCBI mRatBN7.2 15 24,361,924 - 24,363,633 (-) NCBI Rnor_5.0 15 31,897,124 - 31,898,675 (-) NCBI RGSC_v3.4 15 27,123,440 - 27,124,991 (-) RGD Celera 15 24,679,524 - 24,681,067 (-) RGD
Sequence:
GGGGAAAAACTGTCTTCCAATTTGCTCTGGAATTCAAACGTTTAGCAACACACGAGCAGAAAAACCCCTATGGATATGGAGAAGTACCTCTTTCCGTTTTCACTGCTTATATTGGTGCTTGGATGGGT CCATCTTTACCTGGGTGGGGAATCTAGGGAATCATCGGCGGATAAGTTTAAGAGGCAGCACATGGACACAGAGGGTCCCTCCAAGAGCAGCCCCACCTACTGTAACCAGATGATGAAGCGCCAGGGGA TGACCAAGGGGTCATGCAAGCCAGTGAACACCTTCGTGCATGAACCCTTGGAGGATGTCCAGGCCATCTGCTCCCAGGGACAAGTGACCTGCAAGAATGGGAGGAACAACTGCCACAAGAGCAGCTCC ACCCTGCGCATCACTGACTGCCGCCTGAAGGGCAGCTCCAAGTATCCCAATTGCGACTACACAACCACTGACAGCCAGAAGCACATCATCATTGCTTGTGACGGGAACCCCTACGTCCCAGTCCACTT CGATGCTTCCGTGTAGGGCTTCACGTAGGCCAAACCAGTGAGATGTCCGTGTCTCCCATCATGGCAACACCTGCCTCCCCTCTCGATCATTCTTTCCCTGAGAGAAATAATTCTTGTTAGGACTTCCA TCCAACCAAACATTCGTTCCTGTCCCGTGTCCTGTTCCCAGACCCCTCTCCAGACACAGACAAATGAAGCAAGATGGCCCTCACCAGAGCATGTCCCTTCAACCTTAGACTTTCCCGACTTAGAACCA AATAAAATTCTGTCCATTAT
hide sequence
RefSeq Acc Id:
NP_001025075 ⟸ NM_001029904
- Peptide Label:
precursor
- UniProtKB:
P00684 (UniProtKB/Swiss-Prot), A6KED8 (UniProtKB/TrEMBL)
- Sequence:
MDMEKYLFPFSLLILVLGWVHLYLGGESRESSADKFKRQHMDTEGPSKSSPTYCNQMMKRQGMTKGSCKPVNTFVHEPLEDVQAICSQGQVTCKNGRNNCHKSSSTLRITDCRLKGSSKYPNCDYTTT DSQKHIIIACDGNPYVPVHFDASV
hide sequence
Ensembl Acc Id:
ENSRNOP00000068653 ⟸ ENSRNOT00000086427
Ensembl Acc Id:
ENSRNOP00000072263 ⟸ ENSRNOT00000082938
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Rnase1
ribonuclease A family member 1, pancreatic
LOC103690354
ribonuclease pancreatic beta-type
Data merged from RGD:9117758
737654
PROVISIONAL
2016-01-27
Rnase1
ribonuclease A family member 1, pancreatic
Rnase1
ribonuclease, RNase A family, 1 (pancreatic)
Nomenclature updated to reflect human and mouse nomenclature
1299863
APPROVED
2014-08-25
LOC103690354
ribonuclease pancreatic beta-type
Symbol and Name status set to provisional
70820
PROVISIONAL
2004-09-10
Rnase1
ribonuclease, RNase A family, 1 (pancreatic)
Rib1
ribonuclease, RNase A family, 1
Symbol and Name updated
1299863
APPROVED
2002-06-10
Rib1
ribonuclease, RNase A family, 1
Name updated
70584
APPROVED
Note Type
Note
Reference
gene_protein
synthesized as a secretory pre-ribonuclease of 152 amino acids
69967