Symbol:
Il34
Name:
interleukin 34
RGD ID:
1586038
Description:
Predicted to enable identical protein binding activity and macrophage colony-stimulating factor receptor binding activity. Predicted to be involved in several processes, including interleukin-34-mediated signaling pathway; positive regulation of cell development; and positive regulation of macromolecule metabolic process. Predicted to act upstream of or within positive regulation of MAP kinase activity and positive regulation of protein tyrosine kinase activity. Predicted to be active in extracellular space. Orthologous to human IL34 (interleukin 34); INTERACTS WITH 2,3,7,8-Tetrachlorodibenzofuran; 3,3',4,4',5-pentachlorobiphenyl; 4,4'-sulfonyldiphenol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
IL-34; interleukin-34; LOC498951; MGC112852; similar to 2010004A03Rik protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
IL34 (interleukin 34) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Il34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Il34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
IL34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
IL34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Il34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
IL34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
IL34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Il34 (interleukin 34) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Il34 (interleukin 34)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
IL34 (interleukin 34)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
il34 (interleukin 34)
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 55,624,368 - 55,690,576 (-) NCBI GRCr8 mRatBN7.2 19 38,714,990 - 38,782,749 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 38,714,991 - 38,764,000 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 45,520,176 - 45,534,560 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 46,173,544 - 46,187,927 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 48,484,111 - 48,498,359 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 40,855,537 - 40,905,007 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 40,855,433 - 40,904,121 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 51,680,005 - 51,729,266 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 40,662,723 - 40,676,634 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 19 38,108,703 - 38,123,111 (-) NCBI Celera Cytogenetic Map 19 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Il34 Rat 1,2-dichloroethane decreases expression ISO Il34 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of IL34 mRNA CTD PMID:28960355 Il34 Rat 17beta-estradiol decreases expression ISO Il34 (Mus musculus) 6480464 Estradiol results in decreased expression of IL34 mRNA CTD PMID:39298647 Il34 Rat 17beta-estradiol decreases expression ISO IL34 (Homo sapiens) 6480464 Estradiol results in decreased expression of IL34 mRNA CTD PMID:36828454 Il34 Rat 2,2',5,5'-tetrachlorobiphenyl decreases expression ISO IL34 (Homo sapiens) 6480464 2 more ... CTD PMID:36804509 Il34 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Il34 Rat 2-hydroxypropanoic acid decreases expression ISO IL34 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of IL34 mRNA CTD PMID:30851411 Il34 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression EXP 6480464 3 more ... CTD PMID:32119087 Il34 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO IL34 (Homo sapiens) 6480464 3 more ... CTD PMID:35618242 Il34 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Il34 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of IL34 mRNA CTD PMID:20188158 Il34 Rat 4,4'-sulfonyldiphenol increases expression ISO Il34 (Mus musculus) 6480464 bisphenol S results in increased expression of IL34 mRNA CTD PMID:38908815 Il34 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of IL34 mRNA CTD PMID:36041667 Il34 Rat 4,4'-sulfonyldiphenol increases methylation ISO Il34 (Mus musculus) 6480464 bisphenol S results in increased methylation of IL34 exon CTD PMID:33297965 Il34 Rat 4-hydroxyphenyl retinamide decreases expression ISO Il34 (Mus musculus) 6480464 Fenretinide results in decreased expression of IL34 mRNA CTD PMID:28973697 Il34 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of IL34 mRNA CTD PMID:30047161 Il34 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of IL34 mRNA CTD PMID:28959563 Il34 Rat all-trans-retinoic acid multiple interactions ISO Il34 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of IL34 mRNA CTD PMID:36189433 Il34 Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of IL34 mRNA CTD PMID:30047161 Il34 Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of IL34 gene CTD PMID:28931070 Il34 Rat benzalkonium chloride decreases expression ISO Il34 (Mus musculus) 6480464 Benzalkonium Compounds results in decreased expression of IL34 mRNA CTD PMID:30171875 Il34 Rat benzo[a]pyrene increases expression ISO Il34 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of IL34 mRNA CTD PMID:23735875 Il34 Rat benzo[a]pyrene increases expression ISO IL34 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of IL34 mRNA CTD PMID:32234424 Il34 Rat benzo[a]pyrene affects methylation ISO IL34 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of IL34 promoter CTD PMID:27901495 Il34 Rat benzo[a]pyrene increases methylation ISO IL34 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of IL34 3' UTR CTD PMID:27901495 Il34 Rat bisphenol A decreases expression ISO Il34 (Mus musculus) 6480464 bisphenol A results in decreased expression of IL34 mRNA CTD PMID:26063408 Il34 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of IL34 mRNA CTD PMID:36041667 Il34 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of IL34 gene CTD PMID:28505145 Il34 Rat bisphenol A increases methylation ISO Il34 (Mus musculus) 6480464 bisphenol A results in increased methylation of IL34 promoter CTD PMID:27312807 Il34 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of IL34 mRNA CTD PMID:25181051 and PMID:38750585 Il34 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of IL34 mRNA CTD PMID:36041667 Il34 Rat calcitriol increases expression ISO IL34 (Homo sapiens) 6480464 Calcitriol results in increased expression of IL34 mRNA CTD PMID:26485663 Il34 Rat clotrimazole increases expression EXP 6480464 Clotrimazole results in increased expression of IL34 mRNA CTD PMID:30047161 Il34 Rat copper(II) sulfate decreases expression ISO IL34 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of IL34 mRNA CTD PMID:19549813 Il34 Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of IL34 mRNA CTD PMID:17005392 Il34 Rat epoxiconazole increases expression ISO Il34 (Mus musculus) 6480464 epoxiconazole results in increased expression of IL34 mRNA CTD PMID:35436446 Il34 Rat fonofos increases methylation ISO IL34 (Homo sapiens) 6480464 Fonofos results in increased methylation of IL34 promoter CTD PMID:22847954 Il34 Rat genistein decreases expression ISO Il34 (Mus musculus) 6480464 Genistein results in decreased expression of IL34 mRNA CTD PMID:32186404 Il34 Rat lead(0) affects expression ISO IL34 (Homo sapiens) 6480464 Lead affects the expression of IL34 mRNA CTD PMID:28903495 Il34 Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of IL34 mRNA CTD PMID:30047161 Il34 Rat microcystin-LR increases expression ISO Il34 (Mus musculus) 6480464 cyanoginosin LR results in increased expression of IL34 mRNA CTD PMID:37342990 Il34 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Il34 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of IL34 mRNA CTD PMID:36189433 Il34 Rat nickel atom decreases expression ISO IL34 (Homo sapiens) 6480464 Nickel results in decreased expression of IL34 mRNA CTD PMID:24768652 and PMID:25583101 Il34 Rat ozone multiple interactions ISO Il34 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of IL34 mRNA CTD PMID:34911549 Il34 Rat paracetamol affects expression ISO Il34 (Mus musculus) 6480464 Acetaminophen affects the expression of IL34 mRNA CTD PMID:17562736 Il34 Rat paracetamol increases expression ISO Il34 (Mus musculus) 6480464 Acetaminophen results in increased expression of IL34 mRNA CTD PMID:34724096 Il34 Rat paraquat decreases expression EXP 6480464 Paraquat results in decreased expression of IL34 mRNA CTD PMID:32680482 Il34 Rat parathion increases methylation ISO IL34 (Homo sapiens) 6480464 Parathion results in increased methylation of IL34 promoter CTD PMID:22847954 Il34 Rat pirinixic acid multiple interactions ISO Il34 (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of IL34 mRNA CTD PMID:19710929 Il34 Rat rac-lactic acid decreases expression ISO IL34 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of IL34 mRNA CTD PMID:30851411 Il34 Rat resveratrol multiple interactions ISO IL34 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of IL34 mRNA CTD PMID:23557933 Il34 Rat silver atom increases expression ISO Il34 (Mus musculus) 6480464 Silver results in increased expression of IL34 mRNA CTD PMID:27131904 Il34 Rat silver(0) increases expression ISO Il34 (Mus musculus) 6480464 Silver results in increased expression of IL34 mRNA CTD PMID:27131904 Il34 Rat Soman decreases expression EXP 6480464 Soman results in decreased expression of IL34 mRNA CTD PMID:19281266 Il34 Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of IL34 mRNA CTD PMID:30047161 Il34 Rat terbufos increases methylation ISO IL34 (Homo sapiens) 6480464 terbufos results in increased methylation of IL34 promoter CTD PMID:22847954 Il34 Rat tetrachloromethane affects expression ISO Il34 (Mus musculus) 6480464 Carbon Tetrachloride affects the expression of IL34 mRNA CTD PMID:17484886 Il34 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of IL34 mRNA CTD PMID:33387578 Il34 Rat urethane decreases expression ISO IL34 (Homo sapiens) 6480464 Urethane results in decreased expression of IL34 mRNA CTD PMID:28818685 Il34 Rat valproic acid increases methylation ISO IL34 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of IL34 gene CTD PMID:29154799
1,2-dichloroethane (ISO) 17beta-estradiol (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2-hydroxypropanoic acid (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP,ISO) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) acrylamide (EXP) all-trans-retinoic acid (ISO) amitrole (EXP) atrazine (EXP) benzalkonium chloride (ISO) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) bisphenol F (EXP) calcitriol (ISO) clotrimazole (EXP) copper(II) sulfate (ISO) diethylstilbestrol (EXP) epoxiconazole (ISO) fonofos (ISO) genistein (ISO) lead(0) (ISO) methimazole (EXP) microcystin-LR (ISO) mono(2-ethylhexyl) phthalate (ISO) nickel atom (ISO) ozone (ISO) paracetamol (ISO) paraquat (EXP) parathion (ISO) pirinixic acid (ISO) rac-lactic acid (ISO) resveratrol (ISO) silver atom (ISO) silver(0) (ISO) Soman (EXP) sulfadimethoxine (EXP) terbufos (ISO) tetrachloromethane (ISO) trichloroethene (EXP) urethane (ISO) valproic acid (ISO)
Il34 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 55,624,368 - 55,690,576 (-) NCBI GRCr8 mRatBN7.2 19 38,714,990 - 38,782,749 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 38,714,991 - 38,764,000 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 45,520,176 - 45,534,560 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 46,173,544 - 46,187,927 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 48,484,111 - 48,498,359 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 40,855,537 - 40,905,007 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 40,855,433 - 40,904,121 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 51,680,005 - 51,729,266 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 40,662,723 - 40,676,634 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 19 38,108,703 - 38,123,111 (-) NCBI Celera Cytogenetic Map 19 q12 NCBI
IL34 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 16 70,579,899 - 70,660,682 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 16 70,579,895 - 70,660,682 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 16 70,613,802 - 70,694,585 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 16 69,237,969 - 69,252,085 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 16 54,830,211 - 54,914,394 (-) NCBI Celera Cytogenetic Map 16 q22.1 NCBI HuRef 16 56,444,788 - 56,526,038 (+) NCBI HuRef CHM1_1 16 72,021,130 - 72,101,930 (+) NCBI CHM1_1 T2T-CHM13v2.0 16 76,391,088 - 76,471,868 (+) NCBI T2T-CHM13v2.0
Il34 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 111,467,809 - 111,532,579 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 111,468,461 - 111,532,556 (-) Ensembl GRCm39 Ensembl GRCm38 8 110,741,829 - 110,805,949 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 110,741,829 - 110,805,924 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 113,265,729 - 113,329,803 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 113,628,517 - 113,692,549 (-) NCBI MGSCv36 mm8 Celera 8 114,965,768 - 115,029,412 (-) NCBI Celera Cytogenetic Map 8 E1 NCBI cM Map 8 57.68 NCBI
Il34 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955484 3,416,965 - 3,428,574 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955484 3,362,240 - 3,429,031 (+) NCBI ChiLan1.0 ChiLan1.0
IL34 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 18 83,505,787 - 83,583,507 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 16 89,439,379 - 89,512,788 (-) NCBI NHGRI_mPanPan1 PanPan1.1 Ensembl 16 70,480,917 - 70,494,693 (+) Ensembl panpan1.1 panPan2
IL34 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 76,601,310 - 76,612,665 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 76,555,214 - 76,625,012 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 76,562,564 - 76,573,722 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 77,037,777 - 77,049,154 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 76,991,631 - 77,049,148 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 76,859,645 - 76,871,004 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 76,682,464 - 76,693,813 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 77,174,314 - 77,185,475 (+) NCBI UU_Cfam_GSD_1.0
Il34 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409349 36,558,176 - 36,621,152 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936475 22,967,930 - 22,979,641 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936475 22,967,962 - 22,979,954 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
IL34 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 13,588,787 - 13,659,895 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 13,588,748 - 13,679,864 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 13,511,317 - 13,512,804 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
IL34 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 5 53,731,330 - 53,802,142 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 5 53,731,379 - 53,801,650 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666047 16,529,863 - 16,614,250 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Il34
.
Predicted Target Of
Count of predictions: 399 Count of miRNA genes: 224 Interacting mature miRNAs: 263 Transcripts: ENSRNOT00000023823 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
61350 Bp32 Blood pressure QTL 32 0.012 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 19 20483575 57337602 Rat 61447 Tcas1 Tongue tumor susceptibility QTL 1 6.08 tongue integrity trait (VT:0010553) squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875) 19 2316121 47316121 Rat 724546 Kidm3 Kidney mass QTL 3 3.1 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 19 29322490 57337602 Rat 7411549 Bw130 Body weight QTL 130 5 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 19 15455860 57337602 Rat 1358200 Insglur2 Insulin/glucose ratio QTL 2 4.1 blood glucose amount (VT:0000188) serum glucose level (CMO:0000543) 19 33838214 55283146 Rat 1331737 Uae29 Urinary albumin excretion QTL 29 5.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 4096155 55283277 Rat 724518 Uae19 Urinary albumin excretion QTL 19 5.5 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 19 7457249 42983518 Rat 2298478 Eau8 Experimental allergic uveoretinitis QTL 8 0.0163 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 19 17154433 57337602 Rat 8694186 Bw152 Body weight QTL 152 3.34 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 19 569374 45569374 Rat 61423 Cia14 Collagen induced arthritis QTL 14 3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 19 10827970 43544039 Rat 1578764 Stresp19 Stress response QTL 19 3.6 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 19 15630201 57337602 Rat 1331788 Rf45 Renal function QTL 45 2.818 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 19 15605023 46559041 Rat 2317848 Alcrsp21 Alcohol response QTL 21 1.899999976158142 0.05 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 19 3204777 48204777 Rat 9589102 Slep13 Serum leptin concentration QTL 13 4.63 0.001 blood leptin amount (VT:0005667) plasma leptin level (CMO:0000781) 19 569374 45569374 Rat 7247442 Uae39 Urinary albumin excretion QTL 39 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 19 2187927 46708701 Rat 1549835 Tcas7 Tongue tumor susceptibility QTL 7 0.001 tongue integrity trait (VT:0010553) squamous cell carcinoma of the head and neck tumor number (CMO:0001876) 19 24817978 39654489 Rat 724566 Uae12 Urinary albumin excretion QTL 12 5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 2187927 56457239 Rat 724565 Tcas5 Tongue tumor susceptibility QTL 5 10.04 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 19 9977753 39654489 Rat
RH127794
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 19 38,715,040 - 38,715,221 (-) MAPPER mRatBN7.2 Rnor_6.0 19 40,904,133 - 40,904,313 NCBI Rnor6.0 Rnor_5.0 19 51,728,392 - 51,728,572 UniSTS Rnor5.0 RGSC_v3.4 19 40,662,774 - 40,662,954 UniSTS RGSC3.4 Celera 19 38,108,754 - 38,108,934 UniSTS RH 3.4 Map 19 470.1 UniSTS Cytogenetic Map 19 q12 UniSTS
BE120045
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 19 38,717,096 - 38,717,253 (-) MAPPER mRatBN7.2 Rnor_6.0 19 40,902,101 - 40,902,257 NCBI Rnor6.0 Rnor_5.0 19 51,726,360 - 51,726,516 UniSTS Rnor5.0 RGSC_v3.4 19 40,664,830 - 40,664,986 UniSTS RGSC3.4 Celera 19 38,110,810 - 38,110,966 UniSTS RH 3.4 Map 19 471.2 UniSTS Cytogenetic Map 19 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
41
107
91
90
59
25
59
6
210
89
87
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000023823 ⟹ ENSRNOP00000023823
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 19 38,714,991 - 38,764,000 (-) Ensembl Rnor_6.0 Ensembl 19 40,855,433 - 40,904,121 (+) Ensembl
RefSeq Acc Id:
NM_001025766 ⟹ NP_001020937
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,368 - 55,638,605 (-) NCBI mRatBN7.2 19 38,714,990 - 38,729,226 (-) NCBI Rnor_6.0 19 40,890,544 - 40,904,364 (+) NCBI Rnor_5.0 19 51,680,005 - 51,729,266 (+) NCBI RGSC_v3.4 19 40,662,723 - 40,676,634 (-) RGD Celera 19 38,108,703 - 38,123,111 (-) RGD
Sequence:
CTGCAGTCGGGAGAAACCAGAGAAAGCGCCACCCAGCCCCAGATTCCAAGAGGCCTGCTGGGGACTCCCTTCTCTTCCTCCTCCTTCTCCTCTCCCTCTTCCTCCTCCTCCTGAGACCCCAAAGCCAC
hide sequence
RefSeq Acc Id:
XM_039097930 ⟹ XP_038953858
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,368 - 55,688,428 (-) NCBI mRatBN7.2 19 38,714,990 - 38,779,042 (-) NCBI
RefSeq Acc Id:
XM_039097931 ⟹ XP_038953859
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,368 - 55,641,484 (-) NCBI mRatBN7.2 19 38,714,990 - 38,732,293 (-) NCBI
RefSeq Acc Id:
XM_039097932 ⟹ XP_038953860
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,368 - 55,688,426 (-) NCBI mRatBN7.2 19 38,714,990 - 38,779,053 (-) NCBI
RefSeq Acc Id:
XM_039097933 ⟹ XP_038953861
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,809 - 55,690,576 (-) NCBI mRatBN7.2 19 38,715,460 - 38,782,749 (-) NCBI
RefSeq Acc Id:
XM_063278199 ⟹ XP_063134269
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 55,624,368 - 55,688,114 (-) NCBI
RefSeq Acc Id:
NP_001020937 ⟸ NM_001025766
- Peptide Label:
precursor
- UniProtKB:
Q4KM46 (UniProtKB/Swiss-Prot)
- Sequence:
MPWGLAWLYCLGILLDVALGNENLEIWTLAQDKECDLTGYLRGKLQYKNRLQYMKHYFPINYRIAVPYEGVLRVANITRLKAHVSERELRYLWVLVSLNATESVLDVLLEGHPSWKYLQEVQTLLENV
hide sequence
Ensembl Acc Id:
ENSRNOP00000023823 ⟸ ENSRNOT00000023823
RefSeq Acc Id:
XP_038953860 ⟸ XM_039097932
- Peptide Label:
isoform X2
RefSeq Acc Id:
XP_038953858 ⟸ XM_039097930
- Peptide Label:
isoform X1
RefSeq Acc Id:
XP_038953859 ⟸ XM_039097931
- Peptide Label:
isoform X1
RefSeq Acc Id:
XP_038953861 ⟸ XM_039097933
- Peptide Label:
isoform X3
RefSeq Acc Id:
XP_063134269 ⟸ XM_063278199
- Peptide Label:
isoform X1
- UniProtKB:
A0A140TAD0 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-10-23
Il34
interleukin 34
LOC498951
similar to 2010004A03Rik protein
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-11-19
LOC498951
similar to 2010004A03Rik protein
Symbol and Name status set to provisional
70820 PROVISIONAL
