Gene: LOC103692795 (uncharacterized LOC103692795) Rattus norvegicus |
|
Analyze |
|
Symbol: |
LOC103692795 |
Name: |
uncharacterized LOC103692795 |
RGD ID: |
9149203 |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC102552467; uncharacterized LOC102552467 |
Latest Assembly: |
mRatBN7.2 - mRatBN7.2 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 7 | 16,606,422 - 16,625,453 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 7 | 15,911,077 - 15,922,065 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 7 | 15,903,881 - 15,929,311 (-) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 | 7 | 20,482,096 - 20,485,714 (-) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_5.0 | 7 | 20,550,013 - 20,554,598 (-) | NCBI | Rnor5.0 | Rnor_5.0 | rn5 | Rnor5.0 | Cytogenetic Map | 7 | q13 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (mRatBN7.2)
61410 | Bw19 | Body weight QTL 19 | 6.2 | 0.001 | body mass (VT:0001259) | body weight (CMO:0000012) | 7 | 1 | 44782185 | Rat | 1300176 | Hrtrt10 | Heart rate QTL 10 | 3.19 | | heart pumping trait (VT:2000009) | heart rate (CMO:0000002) | 7 | 664270 | 26029351 | Rat | 9590102 | Sffal5 | Serum free fatty acids level QTL 5 | 8.62 | 0.001 | blood free fatty acid amount (VT:0001553) | plasma free fatty acids level (CMO:0000546) | 7 | 5329019 | 50329019 | Rat | 1578652 | Bmd15 | Bone mineral density QTL 15 | 5.2 | | femur mineral mass (VT:0010011) | trabecular volumetric bone mineral density (CMO:0001729) | 7 | 9866467 | 60460686 | Rat | 1643004 | Pain2 | Pain QTL 2 | 1 | | mechanical nociception trait (VT:0002734) | self mutilation severity score (CMO:0002145) | 7 | 9462246 | 98011544 | Rat | 631503 | Bp102 | Blood pressure QTL 102 | 1.9 | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 7 | 1 | 44822433 | Rat | 634336 | Anxrr17 | Anxiety related response QTL 17 | 3.66 | | locomotor behavior trait (VT:0001392) | number of entries into a discrete space in an experimental apparatus (CMO:0000960) | 7 | 924703 | 115097879 | Rat | 10755438 | Coatc9 | Coat color QTL 9 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 3529280 | 48529280 | Rat | 9590142 | Scort5 | Serum corticosterone level QTL 5 | 24.4 | 0.001 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 7 | 1 | 31962314 | Rat | 1582260 | Bw72 | Body weight QTL 72 | 3.2 | 0.0043 | body mass (VT:0001259) | body weight (CMO:0000012) | 7 | 15795565 | 38073970 | Rat | 1582261 | Bw69 | Body weight QTL 69 | 3.2 | 0.0048 | body mass (VT:0001259) | body weight (CMO:0000012) | 7 | 15795565 | 38073970 | Rat | 1582262 | Bw75 | Body weight QTL 75 | 3 | 0.0038 | body mass (VT:0001259) | body weight (CMO:0000012) | 7 | 15795565 | 38073970 | Rat | 2298547 | Neuinf5 | Neuroinflammation QTL 5 | 3.7 | | nervous system integrity trait (VT:0010566) | spinal cord Cd74 protein level (CMO:0002131) | 7 | 9462246 | 58265113 | Rat | 10059592 | Kidm45 | Kidney mass QTL 45 | 3.95 | 0.025 | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 7 | 7573985 | 52573985 | Rat | 2317047 | Wbc4 | White blood cell count QTL 4 | | 0.01 | leukocyte quantity (VT:0000217) | white blood cell count (CMO:0000027) | 7 | 1 | 35342956 | Rat | 10755440 | Coatc10 | Coat color QTL 10 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 7496499 | 52496499 | Rat | 2298550 | Neuinf6 | Neuroinflammation QTL 6 | 3.3 | | nervous system integrity trait (VT:0010566) | spinal cord RT1-B protein level (CMO:0002132) | 7 | 1 | 27829089 | Rat | 738033 | Anxrr6 | Anxiety related response QTL 6 | 4.1 | | exploratory behavior trait (VT:0010471) | percentage of entries into a discrete space in an experimental apparatus (CMO:0000961) | 7 | 15573889 | 60573889 | Rat | 724560 | Plsm3 | Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 | | 0.0003 | tibia length (VT:0004357) | tibia length (CMO:0000450) | 7 | 1 | 34000259 | Rat | 7411566 | Bw136 | Body weight QTL 136 | 10.4 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 7 | 1 | 31962314 | Rat | |
Expression
RNA-SEQ Expression
Sequence
Ensembl Acc Id: |
ENSRNOT00000097698 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 7 | 15,911,319 - 15,929,060 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSRNOT00000098189 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 7 | 15,911,312 - 15,929,123 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSRNOT00000103055 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 7 | 15,911,312 - 15,929,311 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSRNOT00000110702 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 7 | 15,903,881 - 15,929,060 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSRNOT00000119534 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 7 | 15,911,320 - 15,929,311 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_001838764 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,613,971 (-) | NCBI | mRatBN7.2 | 7 | 15,911,077 - 15,918,631 (-) | NCBI | Rnor_6.0 | 7 | 20,482,096 - 20,485,714 (-) | NCBI |
|
Sequence: |
GAGCAGACTGTTCTGCCAGCATCCTGTGTGGAGGCAAAGAGGTTCTGTGAAGAGGCCGGAATGA ACATCTGTGTCCCCAGAGCCAAGCAGTTGCAGGTCCAGCAAGTATCTGCATAGCAAGATTTCCT GAAGTGGAAATGAGTACAGGCCAGGGCAGCACAGCCTGCTTGACTGTAAGAGACTTGTACATAA CATAGCTCCCACTAATTCTTCATTCAACAGAAAACCTGCTGGATAAAAGCCTTGGGCACGAAGT CAGTCAAGTTAAGGTAAAGAGAGCTGCTATTAGAAGAAGCTGCACACTTTGGGGGCAAGCCTGA AACAGTGGCCAAGAACAGAGTCTAATCCACCACCAACATATGATCCTTTGCTGGGAAACAAGCC TGCTCTACACAGCCTTGGGAACGAGCTAAGCCAGATTGGGGAATAAGGCAAGGACCATGATTCT ATGTTGGTTTATGGGAGGACAGCACAACACTGACTGAGTTGTTTATAGGCTATAGGCTATGCCT GCTATGTACATATCCCACTCAACATTTGTTTTTATGCCTTCAGAGAATCCTGGGCGGTCTTTAT ATTAAGGATTACCTCAGAAAGTAAACACTTGACTGCAATGTACTATGCTTATATTGTGTGAACA CACATGTGTTCTGTGTTTGGGAGTGTGTATTAGTGTTTCTGTGTGTCTGTGTGTGTTTGTATGT GCACACAGGTATGCATGCCTCCACTGACATTACACTCATCTAATGACCAGAATAAGGAAGGATT AGAGGAAACAATGCAGGACACTCTGAAGCAGAGAGAACTGATCACCCAGGAAAGTGACTTGGG
hide sequence
|
RefSeq Acc Id: |
XR_005487468 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,620,849 (-) | NCBI | mRatBN7.2 | 7 | 15,911,077 - 15,922,065 (-) | NCBI |
|
RefSeq Acc Id: |
XR_005487469 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,609,838 (-) | NCBI | mRatBN7.2 | 7 | 15,911,077 - 15,914,495 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053621 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,036 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053622 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,036 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053623 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,035 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053624 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,033 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053625 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,035 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053626 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,453 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053627 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,624,721 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053628 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,036 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053629 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,038 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053630 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,034 (-) | NCBI |
|
RefSeq Acc Id: |
XR_010053631 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 7 | 16,606,422 - 16,625,037 (-) | NCBI |
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2021-03-09 |
LOC103692795 |
uncharacterized LOC103692795 |
LOC102552467 |
uncharacterized LOC102552467 |
Data merged from RGD:7598387 |
737654 |
PROVISIONAL |
2014-08-25 |
LOC103692795 |
uncharacterized LOC103692795 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
2013-12-18 |
LOC102552467 |
uncharacterized LOC102552467 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|