Gene: Ppfia4 (protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4) Mus musculus
Analyze
Symbol:
Ppfia4
Name:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
RGD ID:
737079
MGI Page
MGI
Description:
Predicted to be involved in synapse organization. Is active in glutamatergic synapse; parallel fiber to Purkinje cell synapse; and presynapse. Is expressed in several structures, including central nervous system; diaphragm; limb segment; retina; and skeletal musculature. Orthologous to human PPFIA4 (PTPRF interacting protein alpha 4).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
100042382; 1110008G13Rik; AI448359; AI852265; C81506; Gm3812; liprin-alpha-4; Liprin-alpha4
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PPFIA4 (PTPRF interacting protein alpha 4) HGNC
EggNOG, Ensembl, HGNC, NCBI, OMA, OrthoDB, Panther, Treefam
Rattus norvegicus (Norway rat):
Ppfia4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Ppfia4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PPFIA4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PPFIA4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Ppfia4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PPFIA4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PPFIA4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Ppfia4 (PTPRF interacting protein alpha 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
PPFIA3 (PTPRF interacting protein alpha 3) HGNC
OrthoMCL
Homo sapiens (human):
PPFIA2 (PTPRF interacting protein alpha 2) HGNC
OrthoMCL
Homo sapiens (human):
PPFIA1 (PTPRF interacting protein alpha 1) HGNC
OrthoMCL
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Ppfia4 (PTPRF interacting protein alpha 4)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
PPFIA4 (PTPRF interacting protein alpha 4)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
ppfia4 (protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB|ZFIN)
Drosophila melanogaster (fruit fly):
Liprin-alpha
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
syd-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 134,224,521 - 134,272,493 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 134,224,521 - 134,260,666 (-) Ensembl GRCm39 Ensembl GRCm38 1 134,296,783 - 134,344,756 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 134,296,783 - 134,332,928 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 136,193,360 - 136,229,505 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 136,113,190 - 136,148,934 (-) NCBI MGSCv36 mm8 Celera 1 136,907,323 - 136,945,050 (-) NCBI Celera Cytogenetic Map 1 E4 NCBI cM Map 1 58.18 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ppfia4 Mouse 1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene multiple interactions EXP 6480464 [2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with more ... CTD PMID:25510870 Ppfia4 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1,2-Dimethylhydrazine results in decreased expression of PPFIA4 mRNA CTD PMID:22206623 Ppfia4 Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of PPFIA4 mRNA CTD PMID:39298647 Ppfia4 Mouse 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions EXP 6480464 [2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with more ... CTD PMID:25510870 Ppfia4 Mouse 2,2',5,5'-tetrachlorobiphenyl multiple interactions EXP 6480464 [2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with more ... CTD PMID:25510870 Ppfia4 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of PPFIA4 mRNA CTD PMID:28922406 Ppfia4 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:620055 6480464 Tetrachlorodibenzodioxin results in increased expression of PPFIA4 mRNA CTD PMID:33387578 Ppfia4 Mouse 2,4,4'-trichlorobiphenyl multiple interactions EXP 6480464 [2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with more ... CTD PMID:25510870 Ppfia4 Mouse 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression EXP 6480464 2,2',4,4',5-brominated diphenyl ether affects the expression of PPFIA4 mRNA CTD PMID:38648751 Ppfia4 Mouse 2,6-dinitrotoluene affects expression ISO RGD:620055 6480464 2,6-dinitrotoluene affects the expression of PPFIA4 mRNA CTD PMID:21346803 Ppfia4 Mouse 3,4-methylenedioxymethamphetamine increases expression EXP 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in increased expression of PPFIA4 mRNA CTD PMID:26251327 Ppfia4 Mouse 4,4'-sulfonyldiphenol decreases expression ISO RGD:737078 6480464 bisphenol S results in decreased expression of PPFIA4 mRNA CTD PMID:27685785 Ppfia4 Mouse 4,4'-sulfonyldiphenol affects methylation EXP 6480464 bisphenol S affects the methylation of PPFIA4 gene CTD PMID:31683443 Ppfia4 Mouse 4-nonylphenol multiple interactions ISO RGD:737078 6480464 [4-tert-octylphenol co-treated with 4-nonylphenol] results in decreased expression of PPFIA4 mRNA CTD PMID:23626723 Ppfia4 Mouse 4-tert-Octylphenol multiple interactions ISO RGD:737078 6480464 [4-tert-octylphenol co-treated with 4-nonylphenol] results in decreased expression of PPFIA4 mRNA CTD PMID:23626723 Ppfia4 Mouse acrylamide affects expression ISO RGD:620055 6480464 Acrylamide affects the expression of PPFIA4 mRNA CTD PMID:28959563 Ppfia4 Mouse acrylamide decreases expression ISO RGD:737078 6480464 Acrylamide results in decreased expression of PPFIA4 mRNA CTD PMID:32763439 Ppfia4 Mouse acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of PPFIA4 mRNA CTD PMID:30807115 Ppfia4 Mouse aflatoxin B1 decreases methylation ISO RGD:737078 6480464 Aflatoxin B1 results in decreased methylation of PPFIA4 intron CTD PMID:30157460 Ppfia4 Mouse Aflatoxin B2 alpha decreases methylation ISO RGD:737078 6480464 aflatoxin B2 results in decreased methylation of PPFIA4 intron CTD PMID:30157460 Ppfia4 Mouse all-trans-retinoic acid increases expression ISO RGD:737078 6480464 Tretinoin results in increased expression of PPFIA4 mRNA CTD PMID:33167477 Ppfia4 Mouse allethrin multiple interactions ISO RGD:620055 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in more ... CTD PMID:34896426 Ppfia4 Mouse ammonium chloride affects expression ISO RGD:620055 6480464 Ammonium Chloride affects the expression of PPFIA4 mRNA CTD PMID:16483693 Ppfia4 Mouse aristolochic acid A decreases expression ISO RGD:737078 6480464 aristolochic acid I results in decreased expression of PPFIA4 mRNA CTD PMID:33212167 Ppfia4 Mouse arsane affects methylation ISO RGD:737078 6480464 Arsenic affects the methylation of PPFIA4 gene CTD PMID:25304211 Ppfia4 Mouse arsane multiple interactions ISO RGD:737078 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of PPFIA4 more ... CTD PMID:32525701 Ppfia4 Mouse arsenic atom multiple interactions ISO RGD:737078 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of PPFIA4 more ... CTD PMID:32525701 Ppfia4 Mouse arsenic atom affects methylation ISO RGD:737078 6480464 Arsenic affects the methylation of PPFIA4 gene CTD PMID:25304211 Ppfia4 Mouse arsenite(3-) multiple interactions ISO RGD:737078 6480464 arsenite inhibits the reaction [G3BP1 protein binds to PPFIA4 mRNA] CTD PMID:32406909 Ppfia4 Mouse atrazine increases expression ISO RGD:737078 6480464 Atrazine results in increased expression of PPFIA4 mRNA CTD PMID:22378314 Ppfia4 Mouse benzo[a]pyrene decreases methylation ISO RGD:737078 6480464 Benzo(a)pyrene results in decreased methylation of PPFIA4 5' UTR CTD PMID:27901495 Ppfia4 Mouse bisphenol A decreases expression ISO RGD:620055 6480464 bisphenol A results in decreased expression of PPFIA4 mRNA CTD PMID:25181051|PMID:30816183|PMID:32528016|PMID:34947998 Ppfia4 Mouse Bisphenol Z increases expression ISO RGD:737078 6480464 bisphenol Z results in increased expression of PPFIA4 mRNA CTD PMID:32387340 Ppfia4 Mouse bleomycin A2 increases expression EXP 6480464 Bleomycin results in increased expression of PPFIA4 mRNA CTD PMID:30825431 Ppfia4 Mouse bleomycin A2 multiple interactions EXP 6480464 Cannabidiol analog inhibits the reaction [Bleomycin results in increased expression of PPFIA4 mRNA]; lenabasum inhibits more ... CTD PMID:30825431 Ppfia4 Mouse butanal increases expression ISO RGD:737078 6480464 butyraldehyde results in increased expression of PPFIA4 mRNA CTD PMID:26079696 Ppfia4 Mouse cannabidiol multiple interactions EXP 6480464 Cannabidiol analog inhibits the reaction [Bleomycin results in increased expression of PPFIA4 mRNA] CTD PMID:30825431 Ppfia4 Mouse carbamazepine affects expression ISO RGD:737078 6480464 Carbamazepine affects the expression of PPFIA4 mRNA CTD PMID:25979313 Ppfia4 Mouse carbon nanotube decreases expression EXP 6480464 Nanotubes, Carbon analog results in decreased expression of PPFIA4 mRNA CTD PMID:25620056 Ppfia4 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes, Carbon analog results in increased expression of PPFIA4 mRNA; Nanotubes, Carbon results in increased more ... CTD PMID:25554681 Ppfia4 Mouse chlordecone decreases expression EXP 6480464 Chlordecone results in decreased expression of PPFIA4 mRNA CTD PMID:29980752 Ppfia4 Mouse cobalt atom multiple interactions ISO RGD:737078 6480464 [tungsten carbide binds to Cobalt] which results in increased expression of PPFIA4 mRNA CTD PMID:20105288 Ppfia4 Mouse cobalt dichloride increases expression ISO RGD:737078 6480464 cobaltous chloride results in increased expression of PPFIA4 mRNA CTD PMID:20105288 Ppfia4 Mouse cyhalothrin multiple interactions ISO RGD:620055 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in more ... CTD PMID:34896426 Ppfia4 Mouse cypermethrin multiple interactions ISO RGD:620055 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in more ... CTD PMID:34896426 Ppfia4 Mouse Dibutyl phosphate affects expression ISO RGD:737078 6480464 di-n-butylphosphoric acid affects the expression of PPFIA4 mRNA CTD PMID:37042841 Ppfia4 Mouse dioxygen increases expression ISO RGD:737078 6480464 Oxygen deficiency results in increased expression of PPFIA4 mRNA CTD PMID:24236059|PMID:26516004 Ppfia4 Mouse dioxygen multiple interactions EXP 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of PPFIA4 mRNA CTD PMID:30529165 Ppfia4 Mouse dorsomorphin multiple interactions ISO RGD:737078 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Ppfia4 Mouse epoxiconazole increases expression EXP 6480464 epoxiconazole results in increased expression of PPFIA4 mRNA CTD PMID:35436446 Ppfia4 Mouse esketamine increases expression ISO RGD:737078 6480464 Esketamine results in increased expression of PPFIA4 mRNA CTD PMID:38219984 Ppfia4 Mouse ethanol decreases expression ISO RGD:737078 6480464 Ethanol results in decreased expression of PPFIA4 protein CTD PMID:20621659 Ppfia4 Mouse ethanol multiple interactions EXP 6480464 Ethanol affects the expression of and affects the splicing of PPFIA4 mRNA CTD PMID:30319688 Ppfia4 Mouse ethanol multiple interactions ISO RGD:737078 6480464 [Ethanol co-treated with Folic Acid] results in increased expression of PPFIA4 mRNA CTD PMID:23378141 Ppfia4 Mouse fenvalerate increases expression ISO RGD:620055 6480464 fenvalerate results in increased expression of PPFIA4 mRNA CTD PMID:30307764 Ppfia4 Mouse fenvalerate multiple interactions ISO RGD:620055 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in more ... CTD PMID:34896426 Ppfia4 Mouse flavonoids decreases expression ISO RGD:620055 6480464 Flavonoids results in decreased expression of PPFIA4 mRNA CTD PMID:18035473 Ppfia4 Mouse folic acid multiple interactions ISO RGD:737078 6480464 [Ethanol co-treated with Folic Acid] results in increased expression of PPFIA4 mRNA CTD PMID:23378141 Ppfia4 Mouse folic acid decreases expression EXP 6480464 Folic Acid results in decreased expression of PPFIA4 mRNA CTD PMID:25629700 Ppfia4 Mouse gemcitabine increases expression ISO RGD:737078 6480464 Gemcitabine results in increased expression of PPFIA4 mRNA CTD PMID:17039268 Ppfia4 Mouse gentamycin decreases expression ISO RGD:620055 6480464 Gentamicins results in decreased expression of PPFIA4 mRNA CTD PMID:33387578 Ppfia4 Mouse GSK-J4 increases expression ISO RGD:737078 6480464 GSK-J4 results in increased expression of PPFIA4 mRNA CTD PMID:29301935 Ppfia4 Mouse hypochlorous acid decreases expression EXP 6480464 Hypochlorous Acid results in decreased expression of PPFIA4 mRNA CTD PMID:19376150 Ppfia4 Mouse lead(0) affects expression ISO RGD:737078 6480464 Lead affects the expression of PPFIA4 mRNA CTD PMID:28903495 Ppfia4 Mouse mercury dibromide decreases expression ISO RGD:737078 6480464 mercuric bromide results in decreased expression of PPFIA4 mRNA CTD PMID:26272509 Ppfia4 Mouse mercury dibromide multiple interactions ISO RGD:737078 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Ppfia4 Mouse methoxychlor affects methylation ISO RGD:620055 6480464 Methoxychlor affects the methylation of PPFIA4 gene CTD PMID:35440735 Ppfia4 Mouse methylmercury chloride decreases expression ISO RGD:737078 6480464 methylmercuric chloride results in decreased expression of PPFIA4 mRNA CTD PMID:23179753|PMID:28001369 Ppfia4 Mouse nickel atom decreases expression ISO RGD:737078 6480464 Nickel results in decreased expression of PPFIA4 mRNA CTD PMID:24768652 Ppfia4 Mouse nickel dichloride increases expression ISO RGD:737078 6480464 nickel chloride results in increased expression of PPFIA4 mRNA CTD PMID:21455298 Ppfia4 Mouse okadaic acid increases expression ISO RGD:737078 6480464 Okadaic Acid results in increased expression of PPFIA4 mRNA CTD PMID:38832940 Ppfia4 Mouse ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased more ... CTD PMID:34911549 Ppfia4 Mouse p-tert-Amylphenol multiple interactions ISO RGD:737078 6480464 [4-tert-octylphenol co-treated with 4-nonylphenol] results in decreased expression of PPFIA4 mRNA CTD PMID:23626723 Ppfia4 Mouse paracetamol increases expression ISO RGD:620055 6480464 Acetaminophen results in increased expression of PPFIA4 mRNA CTD PMID:33387578 Ppfia4 Mouse PCB138 multiple interactions EXP 6480464 [2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with more ... CTD PMID:25510870 Ppfia4 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in increased expression of PPFIA4 mRNA CTD PMID:36331819 Ppfia4 Mouse phenylmercury acetate decreases expression ISO RGD:737078 6480464 Phenylmercuric Acetate results in decreased expression of PPFIA4 mRNA CTD PMID:26272509 Ppfia4 Mouse phenylmercury acetate multiple interactions ISO RGD:737078 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Ppfia4 Mouse propanal increases expression ISO RGD:737078 6480464 propionaldehyde results in increased expression of PPFIA4 mRNA CTD PMID:26079696 Ppfia4 Mouse pyrethrins decreases expression ISO RGD:620055 6480464 Pyrethrins results in decreased expression of PPFIA4 protein CTD PMID:34896426 Ppfia4 Mouse rotenone decreases expression ISO RGD:737078 6480464 Rotenone results in decreased expression of PPFIA4 mRNA CTD PMID:32178731 Ppfia4 Mouse SB 431542 multiple interactions ISO RGD:737078 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Ppfia4 Mouse silicon dioxide decreases expression ISO RGD:737078 6480464 Silicon Dioxide analog results in decreased expression of PPFIA4 mRNA CTD PMID:25895662 Ppfia4 Mouse silicon dioxide increases expression ISO RGD:737078 6480464 Silicon Dioxide results in increased expression of PPFIA4 mRNA CTD PMID:25351596 Ppfia4 Mouse sodium arsenate multiple interactions ISO RGD:737078 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of PPFIA4 more ... CTD PMID:32525701 Ppfia4 Mouse sodium arsenite decreases expression ISO RGD:737078 6480464 sodium arsenite results in decreased expression of PPFIA4 mRNA; sodium arsenite results in decreased expression more ... CTD PMID:21925251|PMID:29301061 Ppfia4 Mouse sunitinib increases expression ISO RGD:737078 6480464 Sunitinib results in increased expression of PPFIA4 mRNA CTD PMID:31533062 Ppfia4 Mouse thapsigargin decreases expression ISO RGD:737078 6480464 Thapsigargin results in decreased expression of PPFIA4 mRNA CTD PMID:22378314 Ppfia4 Mouse thimerosal decreases expression ISO RGD:737078 6480464 Thimerosal results in decreased expression of PPFIA4 mRNA CTD PMID:27188386 Ppfia4 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of PPFIA4 gene CTD PMID:35295148 Ppfia4 Mouse trichloroethene increases expression ISO RGD:620055 6480464 Trichloroethylene results in increased expression of PPFIA4 mRNA CTD PMID:33387578 Ppfia4 Mouse triclosan decreases expression ISO RGD:737078 6480464 Triclosan results in decreased expression of PPFIA4 mRNA CTD PMID:30510588 Ppfia4 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of PPFIA4 mRNA CTD PMID:33045310 Ppfia4 Mouse troglitazone increases expression EXP 6480464 troglitazone results in increased expression of PPFIA4 mRNA CTD PMID:28973697 Ppfia4 Mouse trovafloxacin decreases expression EXP 6480464 trovafloxacin results in decreased expression of PPFIA4 mRNA CTD PMID:35537566 Ppfia4 Mouse Tungsten carbide multiple interactions ISO RGD:737078 6480464 [tungsten carbide binds to Cobalt] which results in increased expression of PPFIA4 mRNA CTD PMID:20105288 Ppfia4 Mouse Tungsten carbide increases expression ISO RGD:737078 6480464 tungsten carbide results in increased expression of PPFIA4 mRNA CTD PMID:20105288 Ppfia4 Mouse tunicamycin decreases expression ISO RGD:737078 6480464 Tunicamycin results in decreased expression of PPFIA4 mRNA CTD PMID:22378314 Ppfia4 Mouse valproic acid increases methylation ISO RGD:737078 6480464 Valproic Acid results in increased methylation of PPFIA4 gene CTD PMID:29154799 Ppfia4 Mouse valproic acid multiple interactions ISO RGD:737078 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Ppfia4 Mouse vorinostat decreases expression ISO RGD:737078 6480464 vorinostat results in decreased expression of PPFIA4 mRNA CTD PMID:27188386
1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene (EXP) 1,2-dimethylhydrazine (EXP) 17beta-estradiol (EXP) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,4'-trichlorobiphenyl (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 2,6-dinitrotoluene (ISO) 3,4-methylenedioxymethamphetamine (EXP) 4,4'-sulfonyldiphenol (EXP,ISO) 4-nonylphenol (ISO) 4-tert-Octylphenol (ISO) acrylamide (EXP,ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (ISO) allethrin (ISO) ammonium chloride (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) atrazine (ISO) benzo[a]pyrene (ISO) bisphenol A (ISO) Bisphenol Z (ISO) bleomycin A2 (EXP) butanal (ISO) cannabidiol (EXP) carbamazepine (ISO) carbon nanotube (EXP) chlordecone (EXP) cobalt atom (ISO) cobalt dichloride (ISO) cyhalothrin (ISO) cypermethrin (ISO) Dibutyl phosphate (ISO) dioxygen (EXP,ISO) dorsomorphin (ISO) epoxiconazole (EXP) esketamine (ISO) ethanol (EXP,ISO) fenvalerate (ISO) flavonoids (ISO) folic acid (EXP,ISO) gemcitabine (ISO) gentamycin (ISO) GSK-J4 (ISO) hypochlorous acid (EXP) lead(0) (ISO) mercury dibromide (ISO) methoxychlor (ISO) methylmercury chloride (ISO) nickel atom (ISO) nickel dichloride (ISO) okadaic acid (ISO) ozone (EXP) p-tert-Amylphenol (ISO) paracetamol (ISO) PCB138 (EXP) perfluorooctane-1-sulfonic acid (EXP) phenylmercury acetate (ISO) propanal (ISO) pyrethrins (ISO) rotenone (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sunitinib (ISO) thapsigargin (ISO) thimerosal (ISO) titanium dioxide (EXP) trichloroethene (ISO) triclosan (ISO) triptonide (EXP) troglitazone (EXP) trovafloxacin (EXP) Tungsten carbide (ISO) tunicamycin (ISO) valproic acid (ISO) vorinostat (ISO)
1.
Functional annotation of a full-length mouse cDNA collection.
Kawai J, etal., Nature. 2001 Feb 8;409(6821):685-90.
2.
Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development.
Ko MS, etal., Development 2000 Apr;127(8):1737-49.
3.
Gene discovery by microarray: identification of novel genes induced during growth factor-mediated muscle cell survival and differentiation.
Kuninger D, etal., Genomics 2004 Nov;84(5):876-89.
4.
Electronic Transfer of Homolog Data
MGD and Homologene mouse data transfer
5.
Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs.
Okazaki Y, etal., Nature. 2002 Dec 5;420(6915):563-73.
6.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
7.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
Ppfia4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 134,224,521 - 134,272,493 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 134,224,521 - 134,260,666 (-) Ensembl GRCm39 Ensembl GRCm38 1 134,296,783 - 134,344,756 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 134,296,783 - 134,332,928 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 136,193,360 - 136,229,505 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 136,113,190 - 136,148,934 (-) NCBI MGSCv36 mm8 Celera 1 136,907,323 - 136,945,050 (-) NCBI Celera Cytogenetic Map 1 E4 NCBI cM Map 1 58.18 NCBI
PPFIA4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 203,026,491 - 203,078,736 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 203,026,491 - 203,078,740 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 202,995,619 - 203,047,864 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 201,286,934 - 201,314,487 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 199,751,967 - 199,779,520 NCBI Celera 1 176,149,565 - 176,177,122 (+) NCBI Celera Cytogenetic Map 1 q32.1 NCBI HuRef 1 174,185,942 - 174,213,472 (+) NCBI HuRef CHM1_1 1 204,442,625 - 204,470,214 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 202,289,215 - 202,341,489 (+) NCBI T2T-CHM13v2.0
Ppfia4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 48,305,844 - 48,354,329 (-) NCBI GRCr8 mRatBN7.2 13 45,753,827 - 45,802,305 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 45,753,827 - 45,802,261 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 48,361,659 - 48,409,556 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 49,649,729 - 49,697,621 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 46,914,476 - 46,962,738 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 51,134,831 - 51,183,321 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 51,134,525 - 51,183,269 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 56,191,119 - 56,239,610 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 47,252,084 - 47,300,744 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 47,266,851 - 47,298,660 (-) NCBI Celera 13 46,081,944 - 46,130,233 (-) NCBI Celera Cytogenetic Map 13 q13 NCBI
Ppfia4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955406 39,047,019 - 39,092,597 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955406 39,047,069 - 39,094,663 (+) NCBI ChiLan1.0 ChiLan1.0
PPFIA4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 46,299,230 - 46,351,777 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 46,266,286 - 46,318,804 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 178,628,003 - 178,680,528 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 182,922,756 - 182,975,300 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 182,922,758 - 182,975,300 (+) Ensembl panpan1.1 panPan2
PPFIA4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 118,795 - 164,937 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 120,908 - 164,964 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 174,541 - 221,262 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 129,327 - 176,049 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 129,334 - 174,840 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 117,584 - 164,287 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 227,086 - 273,816 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 249,627 - 296,320 (-) NCBI UU_Cfam_GSD_1.0
Ppfia4 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 72,280,151 - 72,330,803 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936567 1,517,038 - 1,553,736 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936567 1,514,831 - 1,565,467 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PPFIA4 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 113,727,855 - 113,777,766 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 113,727,857 - 113,777,772 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 125,188,699 - 125,238,345 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PPFIA4 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 25 26,274,388 - 26,327,507 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 25 26,276,014 - 26,305,025 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666055 27,050,300 - 27,104,334 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Ppfia4
.
Predicted Target Of
Count of predictions: 1086 Count of miRNA genes: 540 Interacting mature miRNAs: 671 Transcripts: ENSMUST00000168515 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 27095901 Scvln8_m sacral vertebrae length 2, 10 week (mouse) 1 94127725 172027567 Mouse 1302098 Eila1_m ethanol induced locomotor activity 1 (mouse) Not determined 1 112008822 175468938 Mouse 1302161 Exq2_m exploratory and excitability QTL 2 (mouse) Not determined 1 118099720 152099816 Mouse 27226779 Tibl1_m tibia length 1, 5 week (mouse) 1 95527725 162027569 Mouse 27226714 Metcl1_m metatarsal-calcaneal length 1, 5 week (mouse) 1 121727729 139727738 Mouse 14746980 Manh50_m mandible shape 50 (mouse) 1 134131564 168131564 Mouse 10412185 Hcs9_m hepatocarcinogenesis susceptibility 9 (mouse) Not determined 1 63854690 189303617 Mouse 1301979 Melm1_m melanoma modifier 1 (mouse) Not determined 1 109638262 143638479 Mouse 1301722 Cia9_m collagen induced arthritis QTL 9 (mouse) Not determined 1 45783900 189303617 Mouse 13824984 Twq5_m testis weight QTL 5 (mouse) 1 3069992 184732197 Mouse 1301149 Lrnx12_m learning-contextual 12 (mouse) Not determined 1 112008822 168186402 Mouse 27226767 Tibl10_m tibia length 10, 10 week (mouse) 1 121727729 164827569 Mouse 12790994 Aaaq1_m aortic arch angle QTL 1 (mouse) 1 109495943 143495943 Mouse 10045640 Jckm4_m juvenile cystic kidney modifier 4 (mouse) Not determined 1 116290836 150290937 Mouse 1301249 Sbw1_m splenomegaly-NZB x NZW 1 (mouse) Not determined 1 112131005 146131085 Mouse 1301193 Lxw3_m lupus BXSB x NZW 3 (mouse) Not determined 1 102968534 136968667 Mouse 1558860 W10q7_m weight 10 weeks QTL 7 (mouse) Not determined 1 34760138 150193871 Mouse 10412162 Nobq3_m New Zealand obese QTL 3 (mouse) Not determined 1 103933405 191225397 Mouse 12880408 V125Dq3_m vitamin D active form serum level QTL 3 (mouse) 1 122927738 156927738 Mouse 27095935 Ulnl5_m ulna length 5, 10 week (mouse) 1 128727737 181327565 Mouse 1302128 Ity3_m immunity to S. typhimurium 3 (mouse) Not determined 11 131156308 165139464 Mouse 1357488 Splq3_m spleen weight QTL 3 (mouse) Not determined 1 34760138 150193871 Mouse 4141914 Gcsfis_m G-CSF induced splenomegaly (mouse) Not determined 74516235 148715579 Mouse 27095928 Pglq6_m pelvic girdle length QTL 6, 10 week (mouse) 1 75976637 148775742 Mouse 13524520 Bodwtq1_m body wweight QTL 1 (mouse) 1 131191160 135621161 Mouse 27226743 Metcl7_m metatarsal-calcaneal length 7, 10 week (mouse) 1 121727729 153875746 Mouse 1357439 Popoa_m premature ovulation and primary oocyte arrest (mouse) Not determined 1 82643189 135615379 Mouse 27226740 Metcl13_m metatarsal-calcaneal length 13, 16 week (mouse) 1 121727729 153775746 Mouse 4142291 Aec2_m autoimmune exocrinopathy 2 (mouse) Not determined 52457737 182250592 Mouse 1357753 Kidq2_m kidney weight QTL 2 (mouse) Not determined 1 34760138 150193871 Mouse 1300989 Lrdg1_m light induced retinal degeneration 1 (mouse) Not determined 1 73755175 147125370 Mouse 27226799 Feml5_m femur length 5, 5 week (mouse) 1 122027729 164827569 Mouse 27095913 Scvln2_m sacral vertebrae length 2, 5 week (mouse) 1 94127725 148775742 Mouse 1357600 Obq17_m obesity QTL 17 (mouse) Not determined 1 110553179 144553298 Mouse 1301350 Nidd4k_m Nidd4 on KK-A (mouse) Not determined 7 82291982 147125370 Mouse 27095915 Scvln13_m sacral vertebrae length 2, 16 week (mouse) 1 117527730 179827565 Mouse 13513913 Heal51_m wound healing/ regeneration 51 (mouse) 1 131780648 135499606 Mouse 1300841 Ssial1_m susceptibility to sialadenitis 1 (mouse) Not determined 1 63920002 153557562 Mouse 26884448 Sklq1_m skull length QTL 1, 5 week (mouse) 1 75976637 181327565 Mouse 1301608 Emo3_m emotionality 3 (mouse) Not determined 1 129130858 163130993 Mouse 10401248 Bglu12_m blood glucose level 12 (mouse) Not determined 1 110553179 144553298 Mouse
AI448359
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 134,298,389 - 134,298,606 UniSTS GRCm38 MGSCv37 1 136,194,966 - 136,195,183 UniSTS GRCm37 Celera 1 136,908,929 - 136,909,146 UniSTS Cytogenetic Map 1 E4 UniSTS Whitehead/MRC_RH 1 1772.32 UniSTS
AI852265
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 134,297,040 - 134,297,122 UniSTS GRCm38 MGSCv37 1 136,193,617 - 136,193,699 UniSTS GRCm37 Celera 1 136,907,580 - 136,907,662 UniSTS Cytogenetic Map 1 E4 UniSTS Whitehead/MRC_RH 1 1776.24 UniSTS
RH127096
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 134,298,447 - 134,298,690 UniSTS GRCm38 MGSCv37 1 136,195,024 - 136,195,267 UniSTS GRCm37 Celera 1 136,908,987 - 136,909,230 UniSTS Cytogenetic Map 1 E4 UniSTS Whitehead/MRC_RH 1 1788.58 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000168515 ⟹ ENSMUSP00000128314
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,224,521 - 134,260,666 (-) Ensembl GRCm38.p6 Ensembl 1 134,296,783 - 134,332,928 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000186553
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,226,119 - 134,239,336 (-) Ensembl GRCm38.p6 Ensembl 1 134,298,381 - 134,311,598 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000186730 ⟹ ENSMUSP00000139800
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,224,522 - 134,255,004 (-) Ensembl GRCm38.p6 Ensembl 1 134,296,784 - 134,327,266 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000186964
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,224,523 - 134,232,584 (-) Ensembl GRCm38.p6 Ensembl 1 134,296,785 - 134,304,846 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000189361 ⟹ ENSMUSP00000139833
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,225,239 - 134,260,666 (-) Ensembl GRCm38.p6 Ensembl 1 134,297,501 - 134,332,928 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000189862
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 134,224,527 - 134,232,546 (-) Ensembl GRCm38.p6 Ensembl 1 134,296,789 - 134,304,808 (-) Ensembl
RefSeq Acc Id:
NM_001144855 ⟹ NP_001138327
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,260,666 (-) NCBI GRCm38 1 134,296,783 - 134,332,928 (-) NCBI MGSCv37 1 136,193,360 - 136,229,505 (-) RGD Celera 1 136,907,323 - 136,945,050 (-) RGD cM Map 1 ENTREZGENE
Sequence:
ACCACACCGCCCTCCAGAAACCATGGGTGTTGCTAGACCCAGCTGGGATTCTGCCAAGCTCTGGTGCTCAGTCTAAGACAAGGGCTGCCTTCCAGCCCTGTTCGCCCAGCCTGTCATGGCCACACACC
hide sequence
RefSeq Acc Id:
NM_001374777 ⟹ NP_001361706
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,454 (-) NCBI GRCm38 1 134,296,783 - 134,344,716 (-) NCBI
Sequence:
GAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTC
hide sequence
RefSeq Acc Id:
XM_006529848 ⟹ XP_006529911
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,487 (-) NCBI GRCm38 1 134,296,783 - 134,344,751 (-) NCBI
Sequence:
CAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCCCTGCT
hide sequence
RefSeq Acc Id:
XM_006529849 ⟹ XP_006529912
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,239,236 - 134,272,491 (-) NCBI GRCm38 1 134,309,734 - 134,344,754 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCCC
hide sequence
RefSeq Acc Id:
XR_001785569
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,226,113 - 134,272,491 (-) NCBI GRCm38 1 134,296,783 - 134,344,755 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCCC
hide sequence
RefSeq Acc Id:
XR_001785570
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,226,113 - 134,272,492 (-) NCBI GRCm38 1 134,296,783 - 134,344,756 (-) NCBI
Sequence:
GGGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCC
hide sequence
RefSeq Acc Id:
XR_001785571
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,491 (-) NCBI GRCm38 1 134,296,783 - 134,344,755 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCCC
hide sequence
RefSeq Acc Id:
XR_004934161
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,226,113 - 134,272,491 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGC
hide sequence
RefSeq Acc Id:
XR_004934162
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,491 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGC
hide sequence
RefSeq Acc Id:
XR_004934163
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,226,113 - 134,272,492 (-) NCBI
Sequence:
GGGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGG
hide sequence
RefSeq Acc Id:
XR_004934164
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,241,368 - 134,272,493 (-) NCBI
Sequence:
TGGGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAG
hide sequence
RefSeq Acc Id:
XR_004934165
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,226,113 - 134,272,491 (-) NCBI
Sequence:
GGGCCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGCAGCTACCTTTGCAGGCTTGCCTCTAGGACGCCTCGCGCTGCCGAGGTCGGGGGCGGCGCCC
hide sequence
RefSeq Acc Id:
XR_004934166
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,282 (-) NCBI
Sequence:
TCCAGCTCCCCTGAACAGTTTGAGGAGGAGTCTCTGTTAGTGCGCCTTGGGAAACAGCCTCTTCTGGTCTGGATGTATCTCTGCGGGGCGCGGAATTCGTTGCCCCTCGCCTTTGCTGTGCCCTGTGC
hide sequence
RefSeq Acc Id:
XR_387189
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,488 (-) NCBI GRCm38 1 134,296,783 - 134,344,752 (-) NCBI
Sequence:
CCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGC
hide sequence
RefSeq Acc Id:
XR_387190
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,288 (-) NCBI GRCm38 1 134,296,783 - 134,344,552 (-) NCBI
Sequence:
CCCAGCTCCAGCTCCCCTGAACAGTTTGAGGAGGAGTCTCTGTTAGTGCGCCTTGGGAAACAGC
hide sequence
RefSeq Acc Id:
XR_387191
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 134,224,521 - 134,272,488 (-) NCBI GRCm38 1 134,296,783 - 134,344,752 (-) NCBI
Sequence:
CCAGGGTATCCGCGGAGGAAGGGGGCGGGTCCTTGAGGCCACGGTACTGGGCGGTGGAGGCTGC
hide sequence
RefSeq Acc Id:
NP_001138327 ⟸ NM_001144855
- Peptide Label:
isoform 1
- UniProtKB:
B8QI36 (UniProtKB/TrEMBL), Q69ZW5 (UniProtKB/TrEMBL)
- Sequence:
MCEVMPTINEGDPLGPPHGADAEANFEQLMVNMLDEREKLLESLRESQETLVATQSRLQDALHERDQLQRHLNSALPQEFATLTRELSMCREQLLEREEEISELKAERNNTRLLLEHLECLVSRHERS
hide sequence
RefSeq Acc Id:
XP_006529911 ⟸ XM_006529848
- Peptide Label:
isoform X1
- UniProtKB:
Q69ZW5 (UniProtKB/TrEMBL)
- Sequence:
MCEVMPTINEGDPLGPPHGADAEANFEQLMVNMLDEREKLLESLRESQETLVATQSRLQDALHE
hide sequence
RefSeq Acc Id:
XP_006529912 ⟸ XM_006529849
- Peptide Label:
isoform X2
- Sequence:
MCEVMPTINEGDPLGPPHGADAEANFEQLMVNMLDEREKLLESLRESQETLVATQSRLQDALHERDQLQRHLNSALPQEFATLTRELSMCREQLLEREEEISELKAERNNTRLLLEHLECLVSRHERS
hide sequence
RefSeq Acc Id:
NP_001361706 ⟸ NM_001374777
- Peptide Label:
isoform 2
- UniProtKB:
A0A087WPM2 (UniProtKB/TrEMBL), Q69ZW5 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSMUSP00000139800 ⟸ ENSMUST00000186730
Ensembl Acc Id:
ENSMUSP00000128314 ⟸ ENSMUST00000168515
Ensembl Acc Id:
ENSMUSP00000139833 ⟸ ENSMUST00000189361
RGD ID: 6875002 Promoter ID: EPDNEW_M951 Type: single initiation site Name: Ppfia4_3 Description: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide, interacting protein , alpha 4 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M953 EPDNEW_M952 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 134,304,584 - 134,304,644 EPDNEW
RGD ID: 6875024 Promoter ID: EPDNEW_M952 Type: multiple initiation site Name: Ppfia4_1 Description: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide, interacting protein , alpha 4 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M951 EPDNEW_M953 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 134,304,836 - 134,304,896 EPDNEW
RGD ID: 6875004 Promoter ID: EPDNEW_M953 Type: single initiation site Name: Ppfia4_2 Description: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide, interacting protein , alpha 4 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M951 EPDNEW_M952 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 134,311,598 - 134,311,658 EPDNEW
RGD ID: 6846637 Promoter ID: MM_ACW:2392 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Brain Transcripts: PPFIA4.ISEP07 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 136,223,471 - 136,223,971 (-) MPROMDB
RGD ID: 6846635 Promoter ID: MM_ACW:2393 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Brain Transcripts: PPFIA4.CSEP07 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 136,224,771 - 136,225,271 (-) MPROMDB
