Symbol:
Mir28b
Name:
microRNA 28b
RGD ID:
5134294
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
mmu-mir-2; mmu-mir-28b
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 73,743,140 - 73,743,219 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 73,743,140 - 73,743,219 (+) Ensembl GRCm39 Ensembl GRCm38 8 73,016,512 - 73,016,591 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 73,016,512 - 73,016,591 (+) Ensembl GRCm38 mm10 GRCm38 Celera 8 77,324,653 - 77,324,732 (+) NCBI Celera Cytogenetic Map 8 B3.3 NCBI cM Map 8 35.08 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 14794 Count of gene targets: 8452 Count of transcripts: 13185 Interacting mature miRNAs: mmu-miR-28b Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
10043992 Hbnr11_m Heligmosomoides bakeri nematode resistance 11 (mouse) Not determined 8 66326836 100326976 Mouse 1301013 Capsq4_m capsaicin sensitivity related QTL 4 (mouse) Not determined 8 36630154 93455280 Mouse 1301717 Adip4_m adiposity 4 (mouse) Not determined 8 48090064 82090180 Mouse 1357715 Alaa3_m alopecia areata 3 (mouse) Not determined 8 49245591 83245673 Mouse 11353828 Gf7_m gonadal fat pad weight 7 (mouse) 8 58928107 92928107 Mouse 14746987 Manh64_m mandible shape 64 (mouse) 8 50505958 84505958 Mouse 1558875 Eae31_m experimental allergic encephalomyelitis susceptibility 31 (mouse) Not determined 8 35109930 115563747 Mouse 1357787 Vtbt5_m vertebral trabecular bone trait 5 (mouse) Not determined 8 66084397 100084549 Mouse 10766453 Char11_m P. chabaudi malaria resistance QTL 11 (mouse) 8 48090064 82090180 Mouse 1301506 Aevm1_m autoimmune extremity vasculitis in MRL mice 1 (mouse) Not determined 8 54740461 88740637 Mouse 1301441 Skull11_m skull morphology 11 (mouse) Not determined 8 48190168 82190288 Mouse 1301952 Im3_m immunoregulatory 3 (mouse) Not determined 8 55159258 89159407 Mouse 1301767 Fcsa2_m femoral cross-sectional area 2 (mouse) Not determined 8 71032003 105032123 Mouse 4140967 Bmd39_m bone mineral density 39 (mouse) Not determined 8 32506572 117965439 Mouse 1357708 Orq1_m ovulation rate QTL 1 (mouse) Not determined 8 71740461 124622354 Mouse 4141285 Tgq18_m triglyceride QTL 18 (mouse) Not determined 64186736 98186736 Mouse 4141797 Skmw16_m skeletal muscle weight 16 (mouse) Not determined 8 64666176 98666325 Mouse 14747005 Mancz7_m mandible centroid size 7 (mouse) 8 50505958 84505958 Mouse 27226754 Femd6_m femur midshaft diameter 6, 10 week (mouse) 8 37867154 110326632 Mouse 10043975 Obq31_m obesity QTL 31 (mouse) Not determined 8 59136404 93136404 Mouse 10412287 Carg3_m Candida albicans resistance gene 3 (mouse) Not determined 8 56298872 90298872 Mouse 1301872 Cd4ts3_m CD4 T cell subset 3 (mouse) Not determined 8 72122809 106123021 Mouse 10766466 Char12_m P. chabaudi malaria resistance QTL 12 (mouse) 8 68722479 83326976 Mouse 11039503 Ccc4_m colitis susceptibility in the Collaborative Cross 4 (mouse) 8 65174237 78002730 Mouse 1301688 Orch6_m autoimmune orchitis resistance 6 (mouse) Not determined 8 61513479 95513605 Mouse 1558780 Idd22_m insulin dependent diabetes susceptibility 22 (mouse) Not determined 8 71829531 105829637 Mouse 12904744 Carcdq1_m cardiac collagen deposition QTL 1 (mouse) 8 40162297 95416226 Mouse 4141395 Char2a_m P. chabaudi malaria resistance QTL 2a (mouse) Not determined 71589427 90929226 Mouse 14700686 Civq3_m cerebral infarct volume QTL 3 (mouse) 8 52334843 86334843 Mouse 4142283 Imraq2_m immune response to AAV2 QTL 2 (mouse) Not determined 8 71032003 105032123 Mouse 4142023 W3q5_m weight 3 weeks QTL 5 (mouse) Not determined 71740461 124622354 Mouse 1301544 Iba3_m induction of brown adipocytes 3 (mouse) Not determined 8 44747914 78748059 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000175399
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 8 73,743,140 - 73,743,219 (+) Ensembl GRCm38.p6 Ensembl 8 73,016,512 - 73,016,591 (+) Ensembl
RefSeq Acc Id:
NR_039551
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 8 73,743,140 - 73,743,219 (+) NCBI GRCm38 8 73,016,512 - 73,016,591 (+) ENTREZGENE Celera 8 77,324,653 - 77,324,732 (+) ENTREZGENE cM Map 8 ENTREZGENE
Sequence:
GACTATAGAAAAGGAGCTCACAATCTATTTAGTGGCAGGCGCACACTGCCAGAATGTGTGAGGCATCTTAATAGTGTGCT
hide sequence
