Symbol: |
Snord111 |
Name: |
small nucleolar RNA, C/D box 111 |
RGD ID: |
2302595 |
MGI Page |
MGI |
Description: |
ASSOCIATED WITH Charcot-Marie-Tooth disease type 2 (ortholog); INTERACTS WITH thalidomide; valproic acid (ortholog); versicolorin A (ortholog) |
Type: |
snorna
|
RefSeq Status: |
PROVISIONAL |
Previously known as: |
MBII-; MBII-82 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 8 | 111,565,167 - 111,565,230 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 8 | 111,565,160 - 111,565,248 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 8 | 110,838,535 - 110,838,598 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 8 | 110,838,528 - 110,838,616 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 8 | 113,362,435 - 113,362,498 (-) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | Celera | 8 | 115,062,073 - 115,062,136 (-) | NCBI | | Celera | | | Cytogenetic Map | 8 | E1 | NCBI | | | | | cM Map | 8 | 57.75 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Snord111 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 8 | 111,565,167 - 111,565,230 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 8 | 111,565,160 - 111,565,248 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 8 | 110,838,535 - 110,838,598 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 8 | 110,838,528 - 110,838,616 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 8 | 113,362,435 - 113,362,498 (-) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | Celera | 8 | 115,062,073 - 115,062,136 (-) | NCBI | | Celera | | | Cytogenetic Map | 8 | E1 | NCBI | | | | | cM Map | 8 | 57.75 | NCBI | | | | |
|
SNORD111 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 16 | 70,538,005 - 70,538,098 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 16 | 70,538,005 - 70,538,098 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 16 | 70,571,908 - 70,572,001 (+) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 16 | 69,129,409 - 69,129,502 (+) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 16 | 54,956,138 - 54,956,231 (-) | NCBI | | Celera | | | Cytogenetic Map | 16 | q22.1 | NCBI | | | | | HuRef | 16 | 56,402,979 - 56,403,072 (+) | NCBI | | HuRef | | | CHM1_1 | 16 | 71,979,243 - 71,979,336 (+) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 16 | 76,349,194 - 76,349,287 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
Snord111 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 19 | 55,721,859 - 55,721,947 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 19 | 38,812,486 - 38,812,574 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 19 | 38,812,486 - 38,812,574 (-) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 Ensembl | 19 | 43,399,759 - 43,399,847 (+) | NCBI | Rnor6.0 | | rn6 | Rnor6.0 | Cytogenetic Map | 19 | q12 | NCBI | | | | |
|
LOC119872073 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 5 | 76,464,420 - 76,464,504 (+) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 5 | 76,939,539 - 76,939,623 (+) | NCBI | | ROS_Cfam_1.0 | | | UMICH_Zoey_3.1 | 5 | 76,761,482 - 76,761,566 (+) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 5 | 76,584,557 - 76,584,641 (+) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 5 | 77,077,043 - 77,077,127 (+) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
.
Predicted Target Of
Count of predictions: | 140 | Count of miRNA genes: | 129 | Interacting mature miRNAs: | 137 | Transcripts: | ENSMUST00000116746 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
1300560 | Tgl1_m | triglyceride level 1 (mouse) | | | Not determined | | 8 | 102486208 | 111650036 | Mouse | 4141435 | Fbtq3_m | femoral bone trait QTL 3 (mouse) | | | Not determined | | 8 | 100965309 | 130127694 | Mouse | 35673316 | Ari3_m | antibody response to influenza 3, day 15, IgM (mouse) | | | | | 8 | 109426632 | 113826632 | Mouse | 12904960 | Gmmq6_m | gastrocnemius muscle mass QTL 6 (mouse) | | | | | 8 | 111481497 | 130127694 | Mouse | 11252141 | Fdr2_m | fat response to dietary restriction 2 (mouse) | | | | | 8 | 98390634 | 130127694 | Mouse | 1302105 | Im1_m | Immunoregulatory 1 (mouse) | | | Not determined | | 8 | 99828531 | 130127694 | Mouse | 1301080 | Sluc9_m | susceptibility to lung cancer 9 (mouse) | | | Not determined | | 8 | 99828531 | 130127694 | Mouse | 1558875 | Eae31_m | experimental allergic encephalomyelitis susceptibility 31 (mouse) | | | Not determined | | 8 | 35109930 | 115563747 | Mouse | 36049782 | Arc2_m | antibody response to CHIKV 2, day 7, IgM (mouse) | | | | | 8 | 109426632 | 113826632 | Mouse | 36049783 | Arc3_m | antibody response to CHIKV 3, day 7, FRNT50 (mouse) | | | | | 8 | 109426632 | 113826632 | Mouse | 36049780 | Ars12_m | antibody response to SARS-CoV 12, 4 days post-rechallenge, IgM (mouse) | | | | | 8 | 109426632 | 113826632 | Mouse | 14746994 | Manh65_m | mandible shape 65 (mouse) | | | | | 8 | 106489629 | 130127694 | Mouse | 36049781 | Arc1_m | antibody response to CHIKV 1, day 7, IgG (mouse) | | | | | 8 | 109426632 | 113826632 | Mouse | 1301766 | Desp1_m | despair 1 (mouse) | | | Not determined | | 8 | 85486208 | 119486373 | Mouse | 1301253 | Skmw2_m | skeletal muscle weight 2 (mouse) | | | Not determined | | 8 | 86443553 | 120443701 | Mouse | 1301316 | Dntcs1_m | dental caries susceptibility 1 (mouse) | | | Not determined | | 8 | 103443553 | 127781786 | Mouse | 4140967 | Bmd39_m | bone mineral density 39 (mouse) | | | Not determined | | 8 | 32506572 | 117965439 | Mouse | 1357708 | Orq1_m | ovulation rate QTL 1 (mouse) | | | Not determined | | 8 | 71740461 | 124622354 | Mouse | 1300681 | Pgia22_m | proteoglycan induced arthritis 22 (mouse) | | | Not determined | | 8 | 102486208 | 116025457 | Mouse | 10755519 | Wbc1_m | white blood cell count 1 (mouse) | | | | | 8 | 82345783 | 116345783 | Mouse | 1301581 | Char2_m | P. chabaudi malaria resistance QTL 2 (mouse) | | | Not determined | | 8 | 79808806 | 113809031 | Mouse | 1357494 | Obsty2_m | obesity 2 (mouse) | | | Not determined | | 8 | 96245241 | 129745061 | Mouse | 10045619 | Heal14_m | wound healing/regeneration 14 (mouse) | | | Not determined | | 8 | 86443553 | 120443701 | Mouse | 12880431 | Fgf23lq2_m | FGF23 serum level QTL 2 (mouse) | | | | | 8 | 97626632 | 130127694 | Mouse | 10412274 | Leci1_m | leukocyte endothelial cell interactions 1 (mouse) | | | Not determined | | 8 | 110415083 | 130127694 | Mouse | 10755530 | Wbc2_m | white blood cell count 2 (mouse) | | | | | 8 | 81819296 | 115819296 | Mouse | 12904938 | Edlmmq7_m | extensor digitorum longus muscle mass QTL 7 (mouse) | | | | | 8 | 111481497 | 130127694 | Mouse | 10412273 | Fcd1_m | functional capillary density 1 (mouse) | | | Not determined | | 8 | 110415083 | 130127694 | Mouse | 1302049 | Heal1_m | wound healing/regeneration 1 (mouse) | | | Not determined | | 8 | 86443553 | 120443701 | Mouse | 27226796 | Scvln16_m | sacral vertebrae length 2, 16 week (mouse) | | | | | 8 | 89726628 | 130027694 | Mouse | 11079194 | Tpnr6_m | thermal pain response 6 (mouse) | | | | | 8 | 111166632 | 114956740 | Mouse | 27095912 | Pglq14_m | pelvic girdle length QTL 14, 16 week (mouse) | | | | | 8 | 74126628 | 126826739 | Mouse | 4142023 | W3q5_m | weight 3 weeks QTL 5 (mouse) | | | Not determined | | | 71740461 | 124622354 | Mouse | 1301099 | Cbm2_m | cerebellum weight 2 (mouse) | | | Not determined | | 8 | 79245241 | 113245331 | Mouse | 1301481 | Lith11_m | lithogenic gene 11 (mouse) | | | Not determined | | 8 | 98563635 | 130127694 | Mouse | 11532692 | Sluc38a_m | susceptibility to lung cancer 38a (mouse) | | | | | 8 | 105033977 | 130127694 | Mouse | 11532691 | Sluc38_m | susceptibility to lung cancer 38 (mouse) | | | | | 8 | 105033977 | 130127694 | Mouse |
Ensembl Acc Id: |
ENSMUST00000116746 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 8 | 111,565,160 - 111,565,248 (-) | Ensembl | GRCm38.p6 Ensembl | 8 | 110,838,528 - 110,838,616 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_028559 |
RefSeq Status: |
PROVISIONAL |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 8 | 111,565,167 - 111,565,230 (-) | NCBI | GRCm38 | 8 | 110,838,535 - 110,838,598 (-) | ENTREZGENE | MGSCv37 | 8 | 113,362,435 - 113,362,498 (-) | RGD | Celera | 8 | 115,062,073 - 115,062,136 (-) | RGD | cM Map | 8 | | ENTREZGENE |
|
Sequence: |
ATTTAATTCATGTCTCTTCTCTGACATTCTCCTCTGGAGATGATTTTTGCCTTATTGATCTGAT
hide sequence
|
|
|