H3f3c (H3 histone, family 3C) - Rat Genome Database

Name: H3f3c
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: H3f3c (H3 histone, family 3C) Mus musculus

Analyze

Symbol:

H3f3c

Name:

H3 histone, family 3C

RGD ID:

2294834

MGI Page

MGI

Description:

Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Predicted to be involved in nucleosome assembly. Predicted to be located in nucleoplasm. Predicted to be part of nucleosome. Predicted to be active in nucleus. Orthologous to human H3C14 (H3 clustered histone 14).

Type:

protein-coding (Ensembl: processed_pseudogene)

RefSeq Status:

VALIDATED

Previously known as:

embryonic; Gm14384; H3-5; H3mm11; histone H3.3C; predicted gene, OTTMUSG00000016509; uncharacterized protein LOC625328

RGD Orthologs

Human

Bonobo

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	H3Y2 (H3.Y histone 2)	HGNC	Panther
Pan paniscus (bonobo/pygmy chimpanzee):	LOC129397736 (histone H3.X)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Other homologs ²
Homo sapiens (human):	H3C14 (H3 clustered histone 14)	HGNC	HomoloGene
Alliance orthologs ³
Homo sapiens (human):	H3C14 (H3 clustered histone 14)	Alliance	DIOPT (HGNC)
Rattus norvegicus (Norway rat):	H3f3c (H3 histone, family 3C)	Alliance	DIOPT (OMA\|OrthoFinder\|PANTHER\|PhylomeDB\|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):	HHT1	Alliance	DIOPT (Ensembl Compara\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):	HHT2	Alliance	DIOPT (Ensembl Compara\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|SonicParanoid)
Caenorhabditis elegans (roundworm):	his-71	Alliance	DIOPT (OMA\|OrthoFinder\|PANTHER)
Caenorhabditis elegans (roundworm):	his-72	Alliance	DIOPT (OMA\|OrthoFinder\|PANTHER)

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	119,495,597 - 119,496,633 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	2	119,496,107 - 119,496,517 (-)	Ensembl		GRCm39 Ensembl
GRCm38	2	119,665,116 - 119,666,152 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	119,665,626 - 119,666,036 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	2	119,491,362 - 119,491,864 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	2	119,356,527 - 119,357,599 (-)	NCBI		MGSCv36	mm8
Celera	2	120,823,569 - 120,824,143 (-)	NCBI		Celera
Cytogenetic Map	2	E5	NCBI
cM Map	2	59.97	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1-chloro-2,4-dinitrobenzene (ISO)

2,3',4,4',5-Pentachlorobiphenyl (EXP)

4-vinylcyclohexene dioxide (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

nucleosome assembly (ISO)

Cellular Component

nucleoplasm (ISO)

nucleosome (IEA,ISO)

nucleus (IBA,IEA,ISO)

Molecular Function

DNA binding (IEA)

protein heterodimerization activity (IEA)

structural constituent of chromatin (IEA)

Molecular Pathway Annotations Click to see Annotation Detail View

systemic lupus erythematosus pathway (IEA)

References

References - curated

#	Reference Title	Reference Citation
1.	KEGG Annotation Import Pipeline	Pipeline to import KEGG annotations from KEGG into RGD
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:20676102	PMID:21873635	PMID:22705305	PMID:24614311	PMID:25092339	PMID:26388943	PMID:28524856	PMID:30562941	PMID:30713523	PMID:34175335	PMID:36417873

Genomics

Comparative Map Data

H3f3c
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	119,495,597 - 119,496,633 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	2	119,496,107 - 119,496,517 (-)	Ensembl		GRCm39 Ensembl
GRCm38	2	119,665,116 - 119,666,152 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	119,665,626 - 119,666,036 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	2	119,491,362 - 119,491,864 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	2	119,356,527 - 119,357,599 (-)	NCBI		MGSCv36	mm8
Celera	2	120,823,569 - 120,824,143 (-)	NCBI		Celera
Cytogenetic Map	2	E5	NCBI
cM Map	2	59.97	NCBI

H3Y2
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	5	17,490,967 - 17,492,076 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	5	17,490,967 - 17,492,076 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	5	17,491,076 - 17,492,185 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Cytogenetic Map	5	p15.1	NCBI
HuRef	5	17,463,812 - 17,464,219 (-)	NCBI		HuRef
CHM1_1	5	17,491,508 - 17,491,915 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	5	17,430,381 - 17,431,490 (-)	NCBI		T2T-CHM13v2.0

LOC129397736
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	4	17,724,056 - 17,729,485 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	5	15,877,665 - 15,883,177 (-)	NCBI		NHGRI_mPanPan1

miRNA Target Status

Predicted Target Of

	Summary Value
Count of predictions:	57
Count of miRNA genes:	54
Interacting mature miRNAs:	57
Transcripts:	ENSMUST00000119459
Prediction methods:	Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1302033	Nsv1_m	Neuroadapted Sindbis viral RNA level 1 (mouse)			Not determined		2	111623386	145623526	Mouse
1301905	Lgth2_m	body length 2 (mouse)			Not determined		2	111173704	145173821	Mouse
12904007	Cfq7_m	conditioned fear QTL 7 (mouse)					2	118356772	125048872	Mouse
13506762	Tbvq2_m	trabecular bone volume QTL 2 (mouse)					2	115430481	124741920	Mouse
13824983	Vclq1_m	curvilinear velocity QTL 1 (mouse)					2	61830344	136841920	Mouse
1301909	Smdq2_m	segregation of mitochondrial DNA QTL 2 (mouse)			Not determined		2	92778465	126778607	Mouse
11039520	Ltpr2h_m	Leishmania tropica response 2h (mouse)					2	112212746	146213005	Mouse
11039521	Ltpr2g_m	Leishmania tropica response 2g (mouse)					2	115212857	149212994	Mouse
12910799	Pwgrq2_m	pre-weaning growth rate QTL 2 (mouse)					2	118589253	160611165	Mouse
1302174	Dssc2_m	dextran sodium sulfate induced colitis QTL2 (mouse)			Not determined		2	24224632	148700377	Mouse
12910795	Pwbwq5_m	post-weaning body weight QTL 5 (mouse)					2	118589253	160611165	Mouse
11532731	Sluc31a_m	susceptibility to lung cancer 31a (mouse)					2	88015003	122015170	Mouse
27226761	Feml18_m	femur length 18, 16 week (mouse)					2	94230345	154241920	Mouse
12910812	Pwgrq1_m	pre-weaning growth rate QTL 1 (mouse)					2	118589253	160611165	Mouse
12910814	Pwbwq1_m	pre-weaning body weight QTL 1 (mouse)					2	118589253	160611165	Mouse
4141854	T2dm2sa_m	type 2 diabetes mellitus 2 in SMXA RI mice (mouse)			Not determined		2	29307947	148374934	Mouse
12904935	Edlmmq2_m	extensor digitorum longus muscle mass QTL 2 (mouse)					2	97210364	131210364	Mouse
1302071	Fembrs1_m	femur breaking strength 1 (mouse)			Not determined		2	100942930	134943090	Mouse
10045885	Cplaq15_m	circadian period of locomotor activity 15 (mouse)			Not determined		2	110916118	154354667	Mouse
1302203	Gvhd3_m	graft-versus host disease 3 (mouse)			Not determined		2	100942930	134943090	Mouse
1300793	Pcfm2_m	periosteal circumference and femur length 2 (mouse)			Not determined		2	111173704	145173821	Mouse
10412082	Hylaq1_m	Hyperlocomotor activity related QTL 1 (mouse)			Not determined		2	84013198	148667470	Mouse
1300798	Actre3_m	activity response to ethanol 3 (mouse)			Not determined		2	112024987	128173821	Mouse
5491197	Mobq5_m	multigenic obesity QTL 5 (mouse)			Not determined		2	65269746	162518926	Mouse
5491196	Mobq6_m	multigenic obesity QTL 6 (mouse)			Not determined		2	85724269	180896594	Mouse
4142223	Femwf4_m	femur work to failure 4 (mouse)			Not determined			88143423	122143570	Mouse
1301415	Actre4_m	activity response to ethanol 4 (mouse)			Not determined		2	112024987	128173821	Mouse
1301029	T2dm3_m	type 2 diabetes mellitus 3 (mouse)			Not determined		2	114288075	132714157	Mouse
27226788	Feml13_m	femur length 13, 10 week (mouse)					2	102630345	159941920	Mouse
1301295	Prdt1_m	prion disease incubation time 1 (mouse)			Not determined		2	116077623	150077741	Mouse
1558825	Aabpr_m	aberrant activation of B cell proliferation (mouse)			Not determined		2	116033229	122207534	Mouse
12904954	Gmmq2_m	gastrocnemius muscle mass QTL 2 (mouse)					2	97210364	131210364	Mouse
11038696	Ltpr2f_m	Leishmania tropica response 2f (mouse)					2	115212857	149212994	Mouse
1301330	Tbbmd2_m	total body bone mineral density 2 (mouse)			Not determined		2	100942930	134943090	Mouse
11038697	Ltpr2d_m	Leishmania tropica response 2d (mouse)					2	86095716	120095823	Mouse
1301201	Chab1_m	cholesterol absorption 1 (mouse)			Not determined		2	111551028	145551163	Mouse
11038698	Ltpr2c_m	Leishmania tropica response 2c (mouse)					2	86095716	120095823	Mouse
11038699	Ltpr2b_m	Leishmania tropica response 2b (mouse)					2	112212746	146213005	Mouse
11038700	Ltpr2a_m	Leishmania tropica response 2a (mouse)					2	112212746	146213005	Mouse
11038702	Ltpr2_m	Leishmania tropica response 2 (mouse)					2	103095716	167212356	Mouse
11049568	Lmr28c_m	leishmaniasis resistance 28c (mouse)					2	97123370	131123532	Mouse
11049569	Lmr28d_m	leishmaniasis resistance 28d (mouse)					2	97123370	131123532	Mouse
11528549	Sluc31_m	susceptibility to lung cancer 31 (mouse)					2	74524117	129213005	Mouse
1301087	Bbaa15_m	B.burgdorferi-associated arthritis 15 (mouse)			Not determined		2	110489658	144489807	Mouse
1301825	Pbrgcsf1_m	peripheral blood stem cell response to granulocyte colony stimulating factor 1 (mouse)			Not determined		2	106233580	140233729	Mouse
4141802	Ignpq1_m	IgA nephropathy QTL 1 (mouse)			Not determined		2	100824060	134824269	Mouse
1301834	Bits1_m	bitterness sensitivity 1 (mouse)			Not determined		2	87440643	121440778	Mouse
1558990	Skmw9_m	skeletal muscle weight 9 (mouse)			Not determined		2	111173704	145173821	Mouse
11041906	Lmr28a_m	leishmaniasis resistance 28a (mouse)					2	103095716	129213005	Mouse
4141155	Plast2b_m	plasma plant sterol 2b (mouse)			Not determined		2	84013198	148522175	Mouse
1301618	Bglu1_m	blood glucose level 1 (mouse)			Not determined		2	117942930	174324863	Mouse
1300852	Lmr14_m	leishmaniasis resistance 14 (mouse)			Not determined		2	86095716	120095823	Mouse
1301755	Hrq1_m	heart rate quantitative locus 1 (mouse)			Not determined		2	111173704	145173821	Mouse
1301344	Lith1_m	lithogenic gene 1 (mouse)			Not determined		2	45347635	145312647	Mouse
11049565	Lmr28g_m	leishmaniasis resistance 28g (mouse)					2	86095716	120095823	Mouse
1558881	Ses7_m	salmonella enteritidis susceptibility 7 (mouse)			Not determined		2	116306330	150306474	Mouse
1301098	Cd8mts3_m	CD8 memory T cell subset 3 (mouse)			Not determined		2	91089974	125090104	Mouse
10043875	Bw25_m	body weight QTL 25 (mouse)			Not determined		2	107255676	141255676	Mouse

Markers in Region

H3f3a

Mouse Assembly	Chr	Position (strand)	Source
Cytogenetic Map	12	D2	UniSTS
Cytogenetic Map	2	E5	UniSTS
Cytogenetic Map	13	D1	UniSTS
Cytogenetic Map	1	D2.3	UniSTS
Cytogenetic Map	6	E2	UniSTS
Cytogenetic Map	4	C5	UniSTS
Cytogenetic Map	11	B2	UniSTS
cM Map	1		UniSTS
cM Map	13		UniSTS

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001370931	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL844536	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000119459

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	2	119,496,107 - 119,496,517 (-)	Ensembl
GRCm38.p6 Ensembl	2	119,665,626 - 119,666,036 (-)	Ensembl

RefSeq Acc Id:

NM_001370931 ⟹ NP_001357860

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	2	119,495,597 - 119,496,633 (-)	NCBI
GRCm38	2	119,665,116 - 119,666,152 (-)	NCBI

Sequence:

show sequence

GAATTGTGTTCGCAGCCTTCGCCGCGCCGCCGCCGCTCTCCAACGCCAGCGCCGCCTCTCCCTT
GCCGAGCTCCAGCCGAAGGAGAAGGGGGGGTAAGTAAGGAGGTGTCCATACCATGGCTCTTACA
AAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCA
CTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGCACTGT
GGCACTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTT
CAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTA
TTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTG
TGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGC
GGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTCCT
CTTCTTCCTGTTATCAGTAGTTCTGAATATTAGATATTTTTTCCATGGGGTCAAAGGTACCTAA
GTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCATGTTCATT
TGTGTGTGAATTTTTAATATAAATGCAAGATGTAAAGCATTAATGGAAGCAAAATGTTTCAGTG
AACACATTTCAAGAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAA
TGCCAGCATTTGGATTTTTTAAAAATAAGTAAATTTCTTATTGACAGCAACTAAATGGTGTTTG
TAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTAC
ATACAAGTACATGTTTTTAATGTTGTCAGTCTTGTGTGCTGTTCCTGTAAGTTTGCTATTAAAA
TACATTAAACTAT

hide sequence

Protein Sequences


Protein RefSeqs	NP_001357860	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	P02301	(Get FASTA)	NCBI Sequence Viewer

RefSeq Acc Id:	NP_001357860 ⟸ NM_001370931
- UniProtKB:	P02301 (UniProtKB/Swiss-Prot), A1L0U3 (UniProtKB/TrEMBL), A1L0V4 (UniProtKB/TrEMBL)

Protein Domains

Histone H2A/H2B/H3

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-P02301-F1-model_v2	AlphaFold	P02301	1-136	view protein structure

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3650546	AgrOrtholog
Ensembl Genes	ENSMUSG00000082029	Ensembl
Gene3D-CATH	1.10.20.10	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
InterPro	Histone-fold	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
	Histone_H2A/H2B/H3	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
	Histone_H3/CENP-A	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
MGD	MGI:3650546	ENTREZGENE
NCBI Gene	625328	ENTREZGENE
PANTHER	HISTONE H3	UniProtKB/TrEMBL
	HISTONE H3.1	UniProtKB/TrEMBL
	HISTONE H3.3C	UniProtKB/Swiss-Prot
	PTHR11426	UniProtKB/Swiss-Prot
Pfam	Histone	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PhenoGen	H3f3c	PhenoGen
PRINTS	HISTONEH3	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PROSITE	HISTONE_H3_1	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
	HISTONE_H3_2	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
SMART	SM00428	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Superfamily-SCOP	Histone-fold	UniProtKB/TrEMBL, UniProtKB/Swiss-Prot
UniProt	A1L0U3	ENTREZGENE, UniProtKB/TrEMBL
	A1L0V4	ENTREZGENE, UniProtKB/TrEMBL
	H3C_MOUSE	UniProtKB/Swiss-Prot, ENTREZGENE

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Annotations - KEGG (archival)