Symbol:
NR2E3
Name:
nuclear receptor subfamily 2 group E member 3
RGD ID:
18767171
Description:
ENCODES a protein that exhibits DNA binding (inferred); DNA-binding transcription activator activity, RNA polymerase II-specific (inferred); DNA-binding transcription factor activity (inferred); INVOLVED IN cell population proliferation (inferred); eye photoreceptor cell development (inferred); negative regulation of cell population proliferation (inferred); PARTICIPATES IN retinitis pigmentosa pathway; ASSOCIATED WITH Bloom syndrome (ortholog); colorectal cancer (ortholog); cone-rod dystrophy (ortholog); FOUND IN nucleoplasm (inferred); nucleus (inferred); transcription regulator complex (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
photoreceptor-specific nuclear receptor
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 26 11,648,675 - 11,655,408 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 26 11,648,758 - 11,654,850 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 129,915,839 - 129,922,267 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
NR2E3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 26 11,648,675 - 11,655,408 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 26 11,648,758 - 11,654,850 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 129,915,839 - 129,922,267 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
NR2E3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 71,810,554 - 71,818,253 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 71,792,638 - 71,818,259 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 72,102,894 - 72,110,594 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 15 69,889,948 - 69,897,654 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 15 69,889,947 - 69,894,324 NCBI Celera 15 48,989,266 - 48,996,967 (+) NCBI Celera Cytogenetic Map 15 q23 NCBI HuRef 15 48,933,359 - 48,941,065 (+) NCBI HuRef CHM1_1 15 72,221,027 - 72,228,738 (+) NCBI CHM1_1 T2T-CHM13v2.0 15 69,629,504 - 69,637,203 (+) NCBI T2T-CHM13v2.0
Nr2e3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 59,850,054 - 59,868,117 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 59,850,054 - 59,867,942 (-) Ensembl GRCm39 Ensembl GRCm38 9 59,942,771 - 59,960,834 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 59,942,771 - 59,960,659 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 59,790,578 - 59,797,886 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 59,740,777 - 59,748,085 (-) NCBI MGSCv36 mm8 Celera 9 57,170,930 - 57,178,240 (-) NCBI Celera Cytogenetic Map 9 B NCBI cM Map 9 32.35 NCBI
Nr2e3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 69,261,343 - 69,269,081 (-) NCBI GRCr8 mRatBN7.2 8 60,365,581 - 60,373,383 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 60,366,124 - 60,373,163 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 8 64,797,518 - 64,801,587 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 64,797,518 - 64,800,467 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 64,555,324 - 64,557,833 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 8 59,807,339 - 59,816,089 (-) NCBI Celera Cytogenetic Map 8 q24 NCBI
Nr2e3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955450 5,281,707 - 5,286,260 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955450 5,281,707 - 5,286,260 (-) NCBI ChiLan1.0 ChiLan1.0
NR2E3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 16 61,068,810 - 61,081,380 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 15 65,233,083 - 65,253,404 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 15 50,759,707 - 50,767,703 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 15 69,525,351 - 69,533,008 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 15 69,525,351 - 69,533,034 (+) Ensembl panpan1.1 panPan2
NR2E3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 30 35,375,181 - 35,382,398 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 30 35,309,120 - 35,318,785 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 30 35,578,487 - 35,588,153 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 30 35,582,048 - 35,588,151 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 30 35,529,407 - 35,539,055 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 30 35,561,018 - 35,567,025 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 30 35,811,616 - 35,821,244 (+) NCBI UU_Cfam_GSD_1.0
Nr2e3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 113,381,409 - 113,387,591 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936471 31,229,564 - 31,235,654 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936471 31,229,322 - 31,236,093 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NR2E3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 169,360,729 - 169,366,087 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 169,358,662 - 169,373,175 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 187,978,045 - 187,993,204 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Nr2e3
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000011798 ⟹ ENSCSAP00000009859
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 26 11,648,758 - 11,654,850 (-) Ensembl
RefSeq Acc Id:
XM_008016045 ⟹ XP_008014236
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 26 11,648,675 - 11,654,343 (-) NCBI Vero_WHO_p1.0 NW_023666048 129,916,597 - 129,922,267 (+) NCBI
Sequence:
TGAAAATTCCACTCAGGGAGGAGAGAGGGCAGGGAATGGGGCTGGGGGCTGGGGTGTGGATGCACAATGAGGGAGACACTTCTCCGGATGGAAGAGTCACGCGTGGGTTCGTTCAAATGCGGGTGGAC
hide sequence
RefSeq Acc Id:
XM_008016047 ⟹ XP_008014238
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 26 11,648,675 - 11,655,408 (-) NCBI Vero_WHO_p1.0 NW_023666048 129,915,839 - 129,922,267 (+) NCBI
Sequence:
AAAAAAAAAAAAAAAAAAAAAAAAGATTTAAAGTCCTTGGGAGAAGTGGAGTCCATACATCTCT
hide sequence
RefSeq Acc Id:
XP_008014238 ⟸ XM_008016047
- Peptide Label:
isoform X2
- UniProtKB:
A0A0D9RMM0 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_008014236 ⟸ XM_008016045
- Peptide Label:
isoform X1
Ensembl Acc Id:
ENSCSAP00000009859 ⟸ ENSCSAT00000011798
