Advanced Search (OLGA)

Gene: UTF1 (undifferentiated embryonic cell transcription factor 1) Chlorocebus sabaeus

Subscribe to Updates

Analyze

Symbol:

UTF1

Name:

undifferentiated embryonic cell transcription factor 1

RGD ID:

18365752

Description:

ENCODES a protein that exhibits HMG box domain binding (ortholog); TBP-class protein binding (ortholog); INVOLVED IN male gonad development (inferred); positive regulation of transcription by RNA polymerase II (inferred); ASSOCIATED WITH distal 10q deletion syndrome (ortholog); FOUND IN nucleus (inferred)

Type:

protein-coding

RefSeq Status:

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

ChlSab1.1 - Green Monkey 1.1 Assembly

Position:

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Vero_WHO_p1.0	NW_023666048	87,593,456 - 87,595,021 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
UTF1	Green Monkey	distal 10q deletion syndrome		ISO	UTF1 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Distal 10q deletion syndrome	ClinVar	PMID:31690835

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
UTF1	Green Monkey	male gonad development	involved_in	IEA	UniProtKB:Q5T230 and ensembl:ENSP00000305906	150520179		Ensembl	GO_REF:0000107
UTF1	Green Monkey	positive regulation of transcription by RNA polymerase II	involved_in	IEA	UniProtKB:Q5T230 and ensembl:ENSP00000305906	150520179		Ensembl	GO_REF:0000107

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
UTF1	Green Monkey	nucleus	located_in	IEA	UniProtKB:Q5T230 and ensembl:ENSP00000305906	150520179		Ensembl	GO_REF:0000107

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
UTF1	Green Monkey	HMG box domain binding	enables	ISO	UniProtKB:O55170 and UniProtKB:Q05066	9068941	PMID:16582099	UniProt	PMID:16582099
UTF1	Green Monkey	protein binding	enables	ISO	UniProtKB:P16951	9068941	PMID:9748258	MGI	PMID:9748258
UTF1	Green Monkey	protein binding	enables	ISO	UniProtKB:Q15642-2	9068941	PMID:32296183	IntAct	PMID:32296183
UTF1	Green Monkey	protein binding	enables	ISO	UniProtKB:P16951 and UniProtKB:P29037	9068941	PMID:9524124	UniProt	PMID:9524124
UTF1	Green Monkey	protein binding	enables	ISO	UniProtKB:P15336 and UniProtKB:P20226	9068941	PMID:9748258	UniProt	PMID:9748258
UTF1	Green Monkey	TBP-class protein binding	enables	ISO	UniProtKB:P29037	9068941	PMID:9748258	MGI	PMID:9748258
UTF1	Green Monkey	transcription coactivator activity	enables	IEA	UniProtKB:Q5T230 and ensembl:ENSP00000305906	150520179		Ensembl	GO_REF:0000107

UTF1
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Vero_WHO_p1.0	NW_023666048	87,593,456 - 87,595,021 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

UTF1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	10	133,230,217 - 133,231,558 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	10	133,230,217 - 133,231,558 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	10	135,043,721 - 135,045,062 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	10	134,893,768 - 134,895,052 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	10	134,932,658 - 134,933,942	NCBI
Celera	10	128,471,466 - 128,472,747 (-)	NCBI		Celera
Cytogenetic Map	10	q26.3	NCBI
HuRef	10	128,590,264 - 128,591,548 (+)	NCBI		HuRef
CHM1_1	10	135,324,603 - 135,325,887 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	10	134,185,709 - 134,187,050 (+)	NCBI		T2T-CHM13v2.0

Utf1
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	7	139,523,769 - 139,525,025 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	7	139,523,702 - 139,525,025 (+)	Ensembl		GRCm39 Ensembl
GRCm38	7	139,943,856 - 139,945,112 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	7	139,943,789 - 139,945,112 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	7	147,129,755 - 147,131,011 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	7	139,795,176 - 139,796,432 (+)	NCBI		MGSCv36	mm8
Celera	7	139,747,754 - 139,749,010 (+)	NCBI		Celera
Cytogenetic Map	7	F4	NCBI
cM Map	7	84.91	NCBI

Utf1
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	204,169,954 - 204,171,080 (+)	NCBI		GRCr8
mRatBN7.2	1	194,740,339 - 194,741,465 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	194,740,339 - 194,741,465 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	203,101,103 - 203,102,229 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	210,236,142 - 210,237,268 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	202,909,972 - 202,911,098 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	212,281,237 - 212,282,363 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	212,281,237 - 212,282,363 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	219,200,178 - 219,201,304 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	192,417,906 - 192,419,032 (+)	NCBI		Celera
Cytogenetic Map	1	q41	NCBI

Utf1
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0	NW_004955477	10,855,471 - 10,857,044 (+)	NCBI	ChiLan1.0	ChiLan1.0

UTF1
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	8	145,347,730 - 145,352,791 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	10	145,353,087 - 145,358,148 (+)	NCBI		NHGRI_mPanPan1

UTF1
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Dog10K_Boxer_Tasha	28	40,885,694 - 40,887,322 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	28	41,467,017 - 41,468,705 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	28	41,467,017 - 41,468,705 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	28	40,949,347 - 40,950,783 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	28	40,939,436 - 40,940,952 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	28	41,341,980 - 41,343,560 (+)	NCBI		UU_Cfam_GSD_1.0

Utf1
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024407213	6,215,014 - 6,216,312 (-)	NCBI		HiC_Itri_2
SpeTri2.0	NW_004936486	19,345,059 - 19,346,163 (+)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

UTF1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	14	141,190,170 - 141,193,409 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	14	153,154,360 - 153,155,863 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Utf1
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla 1.0	NW_004624737	13,512,558 - 13,513,923 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

ectoderm	endocrine system	hemolymphoid system	mesenchyme	mesoderm	nervous system	reproductive system
70	34	17	31	31	56	20


RefSeq Transcripts	XM_008019134	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACDXN010000016	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XM_008019134 ⟹ XP_008017325

Type:

CODING

Position:

Green Monkey Assembly	Chr	Position (strand)	Source
Vero_WHO_p1.0	NW_023666048	87,593,456 - 87,595,021 (+)	NCBI

Sequence:

show sequence

GCGGGGCGAGGCGGGGCGCGCGGGGCGGGGCGGGGACGGTGGGAGGGTCGTGTAGACCCGGCTCGGACGGCGCGACGGCGGCGCGGGGTGCTCAGAACGCGTGTGGGCGGCCCGGGCGGCGTCCGACC
CCCTCTCCATCTTCGCGCGTCGCGCCCCGGCCCAGGGATGCTGCTGCGGCCCCGCAGGCCGCCCCCGCTCGCGCCCCCCGCGCCGCCGTCGCCCGCTAGCCCCGACCCCGAGCCGCGGCCTCCCGGAG
ACGTCCCAGGGACCCCGCCCCGGAGGCCCGCCTCGCCCAGCGCGCTGGGGGAACTCGGGTTGCCAGTGTCCCCGGGCTCGGCGCAGCGCACGCCCTGGAGCGCCCAGGAGACGGAGCTCCTGCTGGGG
ACGCTGCTGCAACCGGCCGTGTGGCGCGCGCTGCTCCTGGACCGCCGCCAGGCCCTGCCCACCTACCGCCGCGTGTCGGCCGCGCTGGCCCGGCAGCAGGTGCGCCGCACCCCCGCGCAGTGTCGCCG
CCGCTACAAGTTCCTCAAGGACAAGTTTCGCGAGGCGCACGGCCAGCCGCCCGGGCCCTTCGACGAGCAGATCCGGAAGCTCATGGGGCTGCTGGGCGACAACGGGCGCAAACGGCCCCGCCGCCGCT
CCCCCGGGTCCGGGCGCCCCCAGCGCGGCCGCCGCCCGGCCCCCAACGCGCACGCGCCAGCTCAGGCCGAACCAGACGCCACTCCGCTGCCCACCGCCCGCGACCCCGACGCGGACCCCGCCTGGACG
CTCCGCTTCAGCCCGTCCCCGCCGAAGTCTACCGACACCTCCCGCGCCCCCAGATCCCCGCCAGCCCCCGCCCCGACCGCTCTCGCCACCTGCATCCCCGAGGACCGCACGCCCGTCCGCGGTCCGGG
TTCCCCGCCGCCGCCCCTGGCCCGTGAAGACCCCGACTCGCCGCCCGGCCGCCCCGAGGACTGCGCGCCCCCTCCGGCCGCGCCCCCGTCGCTGAACACCGCCCTGCTGCAGACCCTGGGGCACCTGG
GCGACATCGCGAACATCCTGGGCCCGCTGCGCGACCAGCTGCTGACCTTGAACCAGCACGTGGAGCAGCTGCGCGGCGCCTTCGACCAGACGGTGTCCCTGGCCGTGGGCTTCATTCTGGGCAGCGCG
GCGGCCGAGCGAGGGGTCCTCAGGGACCCGTGCCAGTGAGTCCCGGCTGCGGCCAGCCTCCCCTCCCCAGGCCGAGGCCCCTCCGCCCTGCCCCCTCCTGCTGCCTTCCCACCCCCGCTCCTGGGTCC
GTTCAATAAAAAGATTGTTTTCCTAG

hide sequence


Protein RefSeqs	XP_008017325	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSCSAP00000014358
	ENSCSAP00000014358.1

RefSeq Acc Id:	XP_008017325 ⟸ XM_008019134
- UniProtKB:	A0A0D9S0G9 (UniProtKB/TrEMBL)

Database	Acc Id	Source(s)
Ensembl Genes	ENSCSAG00000018350	ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSCSAT00000016449.1	UniProtKB/TrEMBL
Gene3D-CATH	Homeodomain-like	UniProtKB/TrEMBL
InterPro	Myb_DNA-bind_4	UniProtKB/TrEMBL
KEGG Report	csab:103247096	UniProtKB/TrEMBL
NCBI Gene	UTF1	ENTREZGENE
Pfam	Myb_DNA-bind_4	UniProtKB/TrEMBL
UniProt	A0A0D9S0G9	ENTREZGENE, UniProtKB/TrEMBL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar