Symbol: |
LINC01599 (Ensembl: LINC01588) |
Name: |
long intergenic non-protein coding RNA 1599 (Ensembl:long intergenic non-protein coding RNA 1588) |
RGD ID: |
1602424 |
HGNC Page |
HGNC:27285 |
Description: |
ASSOCIATED WITH Brain-Lung-Thyroid Syndrome; L-2-hydroxyglutaric aciduria; L-2-hydroxyglutaric aciduria; INTERACTS WITH aflatoxin B1; Aflatoxin B2 alpha; benzo[a]pyrene |
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
C14orf183; putative uncharacterized protein C14orf183 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Allele / Splice: |
See ClinVar data |
Latest Assembly: |
GRCh38 - Human Genome Assembly GRCh38 |
Position: |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 14 | 50,007,313 - 50,105,043 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 14 | 49,927,213 - 50,105,121 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 14 | 50,474,031 - 50,571,761 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 14 | 49,620,119 - 49,629,111 (-) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 14 | 30,417,514 - 30,426,499 (-) | NCBI | | Celera | | | Cytogenetic Map | 14 | q21.3 | NCBI | | | | | HuRef | 14 | 30,675,796 - 30,684,781 (-) | NCBI | | HuRef | | | CHM1_1 | 14 | 50,489,049 - 50,498,037 (-) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 14 | 44,212,500 - 44,311,279 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
LINC01599 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 14 | 50,007,313 - 50,105,043 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 14 | 49,927,213 - 50,105,121 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 14 | 50,474,031 - 50,571,761 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 14 | 49,620,119 - 49,629,111 (-) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 14 | 30,417,514 - 30,426,499 (-) | NCBI | | Celera | | | Cytogenetic Map | 14 | q21.3 | NCBI | | | | | HuRef | 14 | 30,675,796 - 30,684,781 (-) | NCBI | | HuRef | | | CHM1_1 | 14 | 50,489,049 - 50,498,037 (-) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 14 | 44,212,500 - 44,311,279 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
LOC100980742 (Pan paniscus - bonobo/pygmy chimpanzee) |
Bonobo Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
NHGRI_mPanPan1-v2 | 15 | 51,217,726 - 51,235,381 (-) | NCBI | | NHGRI_mPanPan1-v2 | | | NHGRI_mPanPan1 | 14 | 50,434,230 - 50,449,397 (-) | NCBI | | NHGRI_mPanPan1 | | | Mhudiblu_PPA_v0 | 14 | 30,671,031 - 30,680,109 (-) | NCBI | Mhudiblu_PPA_v0 | Mhudiblu_PPA_v0 | panPan3 | | PanPan1.1 | 14 | 48,976,894 - 48,986,232 (-) | NCBI | panpan1.1 | PanPan1.1 | panPan2 | |
|
LOC103229896 (Chlorocebus sabaeus - green monkey) |
|
.
597450121 | GWAS1546195_H | aspartate aminotransferase measurement QTL GWAS1546195 (human) | | 3e-25 | aspartate aminotransferase measurement | blood aspartate aminotransferase activity level (CMO:0000580) | 14 | 50045629 | 50045630 | Human | 597452842 | GWAS1548916_H | serum alanine aminotransferase measurement QTL GWAS1548916 (human) | | 1e-08 | serum alanine aminotransferase measurement | serum alanine aminotransferase activity level (CMO:0000575) | 14 | 50045393 | 50045394 | Human | 597475914 | GWAS1571988_H | DNA methylation QTL GWAS1571988 (human) | | 9e-09 | DNA methylation | | 14 | 50056489 | 50056490 | Human | 597426196 | GWAS1522270_H | urate measurement QTL GWAS1522270 (human) | | 7e-11 | urate measurement | blood uric acid level (CMO:0000501) | 14 | 50047194 | 50047195 | Human | 597402705 | GWAS1498779_H | Erythema nodosum QTL GWAS1498779 (human) | | 0.000007 | Erythema nodosum | | 14 | 50018609 | 50018610 | Human | 597447639 | GWAS1543713_H | sex hormone-binding globulin measurement QTL GWAS1543713 (human) | | 7e-11 | sex hormone-binding globulin measurement | | 14 | 50045629 | 50045630 | Human | 597422935 | GWAS1519009_H | serum alanine aminotransferase measurement QTL GWAS1519009 (human) | | 1e-15 | serum alanine aminotransferase measurement | serum alanine aminotransferase activity level (CMO:0000575) | 14 | 50045629 | 50045630 | Human | 597403846 | GWAS1499920_H | dementia, Alzheimer's disease neuropathologic change QTL GWAS1499920 (human) | | 0.000003 | dementia, Alzheimer's disease neuropathologic change | | 14 | 50020073 | 50020074 | Human | 597454466 | GWAS1550540_H | aspartate aminotransferase measurement QTL GWAS1550540 (human) | | 4e-16 | aspartate aminotransferase measurement | blood aspartate aminotransferase activity level (CMO:0000580) | 14 | 50045393 | 50045394 | Human |
SHGC-144589 |
Human Assembly | Chr | Position (strand) | Source | JBrowse |
---|
GRCh37 | 14 | 50,558,271 - 50,558,617 | UniSTS | GRCh37 | Build 36 | 14 | 49,628,021 - 49,628,367 | RGD | NCBI36 | Celera | 14 | 30,425,409 - 30,425,755 | RGD | | Cytogenetic Map | 14 | q21.3 | UniSTS | | HuRef | 14 | 30,683,691 - 30,684,037 | UniSTS | |
|
Ensembl Acc Id: |
ENST00000399206 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,712 - 50,007,520 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000528300 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,380 - 50,007,520 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000529902 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,555 - 50,006,519 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000530176 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,982,184 - 50,007,520 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000533506 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,990,990 - 49,993,134 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000553463 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,300 - 50,011,442 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000553914 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,300 - 50,040,209 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000554129 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,595 - 50,041,229 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000556019 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,041,643 - 50,089,175 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000556130 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,946,154 - 49,960,662 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000556434 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,571 - 49,961,960 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000556913 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,941,936 - 49,961,960 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000557142 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,091,555 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000603228 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,105,102 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000603474 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,297 - 50,040,606 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000623502 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,083,651 - 50,092,643 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000635379 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,556 - 50,089,203 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000655269 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,297 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000658223 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,990,944 - 49,993,121 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000685750 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,060,123 - 50,105,102 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000686177 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,348 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000690038 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,040,570 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000700829 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,668 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000701026 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,000,068 - 50,003,441 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000701065 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,558 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000701392 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,039,893 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000701890 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000701948 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,311 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769199 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,006,623 - 50,105,108 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769200 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,105,102 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769201 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,314 - 50,105,102 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769202 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,326 - 50,105,056 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769203 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,020,908 - 50,105,034 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769204 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,021,145 - 50,105,105 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769205 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,577 - 50,105,106 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769206 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,556 - 50,040,605 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769207 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,060,122 - 50,105,077 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769208 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,060,119 - 50,105,064 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769209 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,213 - 49,970,319 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769210 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,554 - 49,970,324 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769211 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,554 - 49,970,291 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769212 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,554 - 49,970,240 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769213 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,047,613 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769214 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,314 - 50,047,550 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769215 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,047,513 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769216 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,047,512 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769217 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,311 - 50,046,531 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769218 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,005,123 - 50,039,854 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769219 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,006,622 - 50,040,209 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769220 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,006,622 - 50,040,203 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769221 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,314 - 50,040,725 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769222 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,040,605 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769223 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,040,570 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769224 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,040,570 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769225 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,315 - 50,040,568 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769226 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,554 - 49,960,729 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769227 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,927,554 - 49,960,677 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769228 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,300 - 50,040,209 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769229 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,311 - 50,040,209 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769230 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,039,867 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769231 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,300 - 50,039,857 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769232 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,039,855 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769233 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,039,854 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769234 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,314 - 50,039,854 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769235 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,039,481 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769236 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,010,355 - 50,039,854 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769237 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,030,234 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769238 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,313 - 50,029,725 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769239 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,962,010 - 49,982,278 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769240 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,149 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769241 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,021,144 - 50,040,568 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769242 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,668 - 50,000,948 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769243 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,007,144 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769244 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,005,460 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769245 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,561 - 50,003,814 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769246 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,003,783 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769247 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,003,427 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769248 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,003,447 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769249 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,003,445 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769250 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,558 - 50,003,437 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769251 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,556 - 50,003,403 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769252 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,149 - 49,992,911 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769253 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,449 - 50,003,160 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769254 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,003,190 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769255 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,556 - 50,003,177 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769256 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,681 - 49,993,095 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769257 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,686 - 49,993,098 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769258 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,595 - 50,002,844 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769259 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,960,416 - 49,970,298 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769260 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,318 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769261 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,312 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769262 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,290 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769263 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,289 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769264 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,001,298 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769265 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769266 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 50,001,152 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769267 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,030,920 - 50,040,605 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769268 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,973,173 - 49,982,796 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769269 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,556 - 50,001,162 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769270 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 50,000,948 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769271 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,561 - 50,000,916 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769272 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,973,173 - 49,982,495 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769273 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,308 - 50,011,343 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769274 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,311 - 50,011,343 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769275 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,007,316 - 50,011,335 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769276 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,999,684 - 50,003,408 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769277 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,000,068 - 50,003,441 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769278 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,000,068 - 50,003,200 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769279 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,575 - 50,040,617 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769280 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,580 - 50,040,570 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769281 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,574 - 50,040,237 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769282 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,060,123 - 50,062,775 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769283 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,578 - 50,040,209 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769284 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,038,111 - 50,040,525 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769285 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,037,579 - 50,039,880 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769286 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,038,370 - 50,040,604 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769287 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,103,347 - 50,105,121 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769288 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,103,438 - 50,105,103 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769289 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 49,993,101 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769290 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 49,993,047 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769291 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,002,285 - 50,003,821 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769292 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,442 - 49,992,916 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769293 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,991,553 - 49,992,914 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769294 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,001,872 - 50,003,179 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769295 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,001,872 - 50,003,166 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769296 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,000,068 - 50,001,288 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769297 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,002,448 - 50,003,460 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769298 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,060,123 - 50,061,128 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769299 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,002,448 - 50,003,438 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769300 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,962,010 - 49,962,964 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769301 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,002,565 - 50,003,429 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769302 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,668 - 49,982,515 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769303 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 49,981,681 - 49,982,509 (-) | Ensembl |
|
Ensembl Acc Id: |
ENST00000769304 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 14 | 50,002,565 - 50,003,302 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_131171 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38 | 14 | 50,007,313 - 50,105,043 (-) | NCBI | CHM1_1 | 14 | 50,412,171 - 50,510,446 (-) | NCBI | T2T-CHM13v2.0 | 14 | 44,212,500 - 44,311,279 (-) | NCBI |
|
Sequence: |
AAAAAAAAAAGCCTACCTTTTGAGTTACTTTCAGAAGATAACACAGGTTCTCGAGGCTGGACAGTCCAAGATCAAGGTGCCTGCATCTGGCGTCTAGTGTGGACCCTATTCCTGGTTTGCAGCATTGT TGGTGCTCTGAGGGTGTCAGCCAGGCCACTCATGCAGACCATTGCGGCAGCACTGAAAATGGAAGAAAGATGGGATTCTGCTGTCTTTTGTTTTGGCTGATGAACAGCACCGAGATGGAGTGGCTCCA GCAGCCAGAACAAGCCACCATCTCCCCTGGGCTTTCACAGTAGCCTCCTGACTGGTCTTGTTGCTTCCACACTTACACTTCCTGTTCTCTGCAAGGCAGCCAGAGTGACCTTTCACTAATCCTTGTAT GACCTCTGAAAATATGACCTGAAGCAGATGGATGCACTCACATAAGAAACATCACCTGTGGCCTTCATCGAAAATGGGCCTGCTGCTTGAAGAAGTTGGGCTCTTGGAGTTCTCTAGCACAGGGGCCA TGAAAATCAATGACTTCCTTGTTTGCTGACGGAGCAGAGGTAGAATCTCTTGGTGTTTCCACGGAGAAAACACTGACCATGAAGAGCCAAGAAAGATGACATGATGAAGCCATCAGGGGAAGCACCAA ACATCCTCAACTCTGCTCACCCATGGTTTTCTCCCGCCCTCCCAGAGCTCCTCCTGCTGATGGGCCCCCGACATGAAACTGGCACTCAGAATGAAGAATGCCTTTTCCAGCCTCCCTCGCTGGTGGAG TCTCCGTGTTCCAGCCAATGAAGTAGGGCATGCAGTTGCCTGCCCCACTGAAGTCAACTTCAGCCTGAAGATTGGGAGACTTCCGAAAGTGGAAAACTTGGAAGGAGGAAGCCTGGACAGCCTGCAGT TGAGGGGACCTGCACAAGCTCACAGGACTCTTCATCACCATGACACCACGCTCACCGCAAAATAAAAATGATCAAACCTGTAAAAAAAAAAAAAAAAAA
hide sequence
|
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2015-03-25 |
LINC01599 |
long intergenic non-protein coding RNA 1599 |
C14orf183 |
chromosome 14 open reading frame 183 |
Symbol and/or name change |
5135510 |
APPROVED |
2011-07-27 |
C14orf183 |
chromosome 14 open reading frame 183 |
LOC196913 |
hypothetical protein LOC196913 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|