Gene: Gm22680 (predicted gene, 22680) Mus musculus |
|
Analyze |
|
Symbol: |
Gm22680 |
Name: |
predicted gene, 22680 |
RGD ID: |
15554315 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC115489086; small nucleolar RNA SNORD30 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 Ensembl - Mouse Genome Assembly GRCm39 Ensembl |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 19 | 8,702,705 - 8,702,773 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 19 | 8,702,705 - 8,702,773 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 19 | 8,725,341 - 8,725,409 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 19 | 8,725,341 - 8,725,409 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 19 | A | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
Comparative Map Data
Gm22680 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 19 | 8,702,705 - 8,702,773 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 19 | 8,702,705 - 8,702,773 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 19 | 8,725,341 - 8,725,409 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 19 | 8,725,341 - 8,725,409 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 19 | A | NCBI | | | | |
|
SNORD30 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | X | 114,017,033 - 114,017,102 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | X | 114,017,033 - 114,017,102 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | Cytogenetic Map | X | q23 | NCBI | | | | | T2T-CHM13v2.0 | X | 112,469,303 - 112,469,372 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
miRNA Target Status
Predicted Target Of
Count of predictions: | 122 | Count of miRNA genes: | 112 | Interacting mature miRNAs: | 116 | Transcripts: | ENSMUST00000083848 | Prediction methods: | Microtar, Miranda, Rnahybrid | Result types: | miRGate_prediction | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000083848 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 19 | 8,702,705 - 8,702,773 (+) | Ensembl | GRCm38.p6 Ensembl | 19 | 8,725,341 - 8,725,409 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004940306 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 19 | 8,702,705 - 8,702,773 (+) | NCBI |
|
Sequence: |
ATATATGATGACTTTCATAGAATCTCGTTCGGCTGATGATTGCTGTTGAGACTTGGAAATCTGA TTTTT
hide sequence
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2020-07-02 |
Gm22680 |
predicted gene, 22680 |
LOC115489086 |
small nucleolar RNA SNORD30 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-30 |
LOC115489086 |
small nucleolar RNA SNORD30 |
Gm22680 |
predicted gene, 22680 |
Symbol and/or name change |
5135510 |
APPROVED |
2020-06-25 |
Gm22680 |
predicted gene, 22680 |
LOC115489086 |
small nucleolar RNA SNORD30 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-19 |
LOC115489086 |
small nucleolar RNA SNORD30 |
Gm22680 |
predicted gene, 22680 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|