Symbol:
Art3
Name:
ADP-ribosyltransferase 3
RGD ID:
1320438
MGI Page
MGI
Description:
Predicted to enable NAD+ poly-ADP-ribosyltransferase activity. Predicted to be located in plasma membrane and side of membrane. Is expressed in 1-cell stage embryo; 2-cell stage embryo; facial ganglion; glossopharyngeal ganglion; and vestibulo-cochlear ganglion. Orthologous to human ART3 (ADP-ribosyltransferase 3 (inactive)).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
4930569O04Rik; ADP-ribosyltransferase C2 and C3 toxin-like 3; ART3 mono(ADP-ribosyl)transferase; ARTC3; ecto-ADP-ribosyltransferase 3; mono(ADP-ribosyl)transferase 3; mono-ADP-ribosyltransferase 3; NAD(P)(+)--arginine ADP-ribosyltransferase 3
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ART3 (ADP-ribosyltransferase 3 (inactive)) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Art3 (ADP-ribosyltransferase 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Art3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ART3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ART3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Art3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ART3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ART3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Art3 (ADP-ribosyltransferase 3 (inactive)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Art3 (ADP-ribosyltransferase 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
ART3 (ADP-ribosyltransferase 3 (inactive))
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
art5
Alliance
DIOPT (OMA|PANTHER|PhylomeDB)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 92,479,659 - 92,562,487 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 92,479,686 - 92,562,487 (+) Ensembl GRCm39 Ensembl GRCm38 5 92,331,799 - 92,414,628 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 92,331,827 - 92,414,628 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 92,760,867 - 92,843,654 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 93,463,343 - 93,489,822 (+) NCBI MGSCv36 mm8 Celera 5 90,475,638 - 90,563,091 (+) NCBI Celera Cytogenetic Map 5 E2 NCBI cM Map 5 46.54 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Art3 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in decreased expression of ART3 mRNA CTD PMID:17942748 Art3 Mouse 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of ART3 mRNA CTD PMID:17555576 and PMID:17942748 Art3 Mouse 17alpha-ethynylestradiol decreases expression ISO Art3 (Rattus norvegicus) 6480464 Ethinyl Estradiol results in decreased expression of ART3 mRNA CTD PMID:17108234 Art3 Mouse 17beta-estradiol multiple interactions ISO ART3 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of ART3 mRNA and [Progesterone co-treated with Estradiol] results in increased expression of ART3 mRNA CTD PMID:17404688 and PMID:20660070 Art3 Mouse 17beta-estradiol decreases expression ISO Art3 (Rattus norvegicus) 6480464 Estradiol results in decreased expression of ART3 mRNA CTD PMID:32145629 Art3 Mouse 2,2',5,5'-tetrachlorobiphenyl increases expression ISO Art3 (Rattus norvegicus) 6480464 2 more ... CTD PMID:23829299 Art3 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in decreased expression of ART3 mRNA CTD PMID:17942748 Art3 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Art3 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of ART3 mRNA CTD PMID:33387578 Art3 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Art3 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ART3 mRNA CTD PMID:32109520 and PMID:34747641 Art3 Mouse 2,3,7,8-Tetrachlorodibenzofuran decreases expression ISO Art3 (Rattus norvegicus) 6480464 2 more ... CTD PMID:32109520 Art3 Mouse 2-palmitoylglycerol increases expression ISO ART3 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of ART3 mRNA CTD PMID:37199045 Art3 Mouse 3,3',5,5'-tetrabromobisphenol A decreases expression EXP 6480464 tetrabromobisphenol A results in decreased expression of ART3 mRNA CTD PMID:25172293 Art3 Mouse 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of ART3 mRNA CTD PMID:26251327 Art3 Mouse 3,7-dihydropurine-6-thione increases expression ISO Art3 (Rattus norvegicus) 6480464 Mercaptopurine results in increased expression of ART3 mRNA CTD PMID:23358152 Art3 Mouse 3-methylcholanthrene multiple interactions EXP 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in increased expression of ART3 mRNA CTD PMID:23519560 Art3 Mouse 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of ART3 mRNA CTD PMID:18648102 Art3 Mouse 4,4'-sulfonyldiphenol affects methylation EXP 6480464 bisphenol S affects the methylation of ART3 gene CTD PMID:31683443 Art3 Mouse 4-hydroxyphenyl retinamide decreases expression EXP 6480464 Fenretinide results in decreased expression of ART3 mRNA CTD PMID:28973697 Art3 Mouse 6-propyl-2-thiouracil decreases expression ISO Art3 (Rattus norvegicus) 6480464 Propylthiouracil results in decreased expression of ART3 mRNA CTD PMID:24780913 and PMID:30047161 Art3 Mouse 6-propyl-2-thiouracil multiple interactions EXP 6480464 [Propylthiouracil co-treated with Iodine deficiency] results in decreased expression of ART3 mRNA CTD PMID:36706583 Art3 Mouse acrylamide decreases expression ISO Art3 (Rattus norvegicus) 6480464 Acrylamide results in decreased expression of ART3 mRNA CTD PMID:28959563 Art3 Mouse acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of ART3 mRNA CTD PMID:30807115 Art3 Mouse all-trans-retinoic acid decreases expression ISO ART3 (Homo sapiens) 6480464 Tretinoin results in decreased expression of ART3 mRNA CTD PMID:33167477 Art3 Mouse alpha-Zearalanol multiple interactions ISO Art3 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of ART3 mRNA CTD PMID:35163327 Art3 Mouse ammonium chloride affects expression ISO Art3 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of ART3 mRNA CTD PMID:16483693 Art3 Mouse amphetamine increases expression ISO Art3 (Rattus norvegicus) 6480464 Amphetamine results in increased expression of ART3 mRNA CTD PMID:30779732 Art3 Mouse arsane affects methylation ISO ART3 (Homo sapiens) 6480464 Arsenic affects the methylation of ART3 gene CTD PMID:25304211 Art3 Mouse arsenic atom affects methylation ISO ART3 (Homo sapiens) 6480464 Arsenic affects the methylation of ART3 gene CTD PMID:25304211 Art3 Mouse atrazine affects methylation ISO Art3 (Rattus norvegicus) 6480464 Atrazine affects the methylation of ART3 gene CTD PMID:28931070 Art3 Mouse benzalkonium chloride decreases expression EXP 6480464 Benzalkonium Compounds results in decreased expression of ART3 mRNA CTD PMID:31199489 Art3 Mouse benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of ART3 mRNA CTD PMID:22228805 Art3 Mouse benzo[a]pyrene increases methylation ISO ART3 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of ART3 promoter CTD PMID:27901495 Art3 Mouse bis(2-ethylhexyl) phthalate decreases expression EXP 6480464 Diethylhexyl Phthalate results in decreased expression of ART3 mRNA CTD PMID:33162236 Art3 Mouse bis(2-ethylhexyl) phthalate increases expression EXP 6480464 Diethylhexyl Phthalate results in increased expression of ART3 mRNA CTD PMID:34319233 Art3 Mouse bisphenol A increases expression ISO Art3 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of ART3 mRNA CTD PMID:25181051 Art3 Mouse bisphenol A affects expression ISO Art3 (Rattus norvegicus) 6480464 bisphenol A affects the expression of ART3 mRNA CTD PMID:32145629 Art3 Mouse bisphenol A multiple interactions ISO Art3 (Rattus norvegicus) 6480464 [bisphenol A co-treated with tributyltin] results in increased expression of ART3 mRNA CTD PMID:31129395 Art3 Mouse bisphenol A decreases expression ISO Art3 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of ART3 mRNA CTD PMID:30816183 and PMID:32528016 Art3 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ART3 mRNA CTD PMID:25594700 Art3 Mouse cadmium dichloride increases methylation ISO Art3 (Rattus norvegicus) 6480464 Cadmium Chloride results in increased methylation of ART3 promoter CTD PMID:22457795 Art3 Mouse cantharidin decreases expression EXP 6480464 Cantharidin results in decreased expression of ART3 mRNA CTD PMID:36907384 Art3 Mouse carbon nanotube decreases expression EXP 6480464 Nanotubes and Carbon analog results in decreased expression of ART3 mRNA CTD PMID:25620056 Art3 Mouse carbon nanotube affects expression EXP 6480464 Nanotubes more ... CTD PMID:25554681 Art3 Mouse CGP 52608 multiple interactions ISO ART3 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to ART3 gene] CTD PMID:28238834 Art3 Mouse clofibrate multiple interactions EXP 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of ART3 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of ART3 mRNA] CTD PMID:17585979 Art3 Mouse crocidolite asbestos decreases expression EXP 6480464 Asbestos and Crocidolite results in decreased expression of ART3 mRNA CTD PMID:29279043 Art3 Mouse cyclosporin A decreases expression ISO ART3 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of ART3 mRNA CTD PMID:20106945 Art3 Mouse dexamethasone increases expression EXP 6480464 Dexamethasone results in increased expression of ART3 mRNA CTD PMID:22733784 Art3 Mouse dibenz[a,h]anthracene increases expression EXP 6480464 1 more ... CTD PMID:26377693 Art3 Mouse diiodine multiple interactions EXP 6480464 [Propylthiouracil co-treated with Iodine deficiency] results in decreased expression of ART3 mRNA CTD PMID:36706583 Art3 Mouse diisononyl phthalate increases expression EXP 6480464 diisononyl phthalate results in increased expression of ART3 mRNA CTD PMID:33391822 Art3 Mouse dioxygen multiple interactions EXP 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of ART3 mRNA CTD PMID:30529165 Art3 Mouse diuron decreases expression ISO Art3 (Rattus norvegicus) 6480464 Diuron results in decreased expression of ART3 mRNA CTD PMID:25152437 Art3 Mouse diuron increases expression ISO Art3 (Rattus norvegicus) 6480464 Diuron results in increased expression of ART3 mRNA CTD PMID:21551480 Art3 Mouse doxorubicin decreases expression ISO ART3 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of ART3 mRNA CTD PMID:29803840 Art3 Mouse genistein decreases expression EXP 6480464 Genistein results in decreased expression of ART3 mRNA CTD PMID:32186404 Art3 Mouse ketamine increases expression ISO Art3 (Rattus norvegicus) 6480464 Ketamine results in increased expression of ART3 mRNA CTD PMID:20080153 Art3 Mouse lead diacetate increases expression EXP 6480464 lead acetate results in increased expression of ART3 mRNA CTD PMID:22609695 Art3 Mouse mercaptopurine increases expression ISO Art3 (Rattus norvegicus) 6480464 Mercaptopurine results in increased expression of ART3 mRNA CTD PMID:23358152 Art3 Mouse methimazole decreases expression ISO Art3 (Rattus norvegicus) 6480464 Methimazole results in decreased expression of ART3 mRNA CTD PMID:30047161 Art3 Mouse Monobutylphthalate decreases expression EXP 6480464 monobutyl phthalate results in decreased expression of ART3 mRNA CTD PMID:35278568 Art3 Mouse morphine multiple interactions ISO Art3 (Rattus norvegicus) 6480464 Morphine deficiency affects the reaction [Morphine deficiency affects the reaction [Morphine results in increased expression of ART3 protein]] and Morphine deficiency affects the reaction [Morphine results in increased expression of ART3 protein] CTD PMID:23056601 Art3 Mouse morphine increases expression ISO Art3 (Rattus norvegicus) 6480464 Morphine results in increased expression of ART3 protein CTD PMID:23056601 Art3 Mouse N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal multiple interactions EXP 6480464 MYBPC3 protein affects the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of ART3 mRNA] CTD PMID:25566086 Art3 Mouse N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal decreases expression EXP 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of ART3 mRNA CTD PMID:25566086 Art3 Mouse nitrofen increases expression ISO Art3 (Rattus norvegicus) 6480464 nitrofen results in increased expression of ART3 mRNA CTD PMID:33484710 Art3 Mouse O-methyleugenol decreases expression ISO ART3 (Homo sapiens) 6480464 methyleugenol results in decreased expression of ART3 mRNA CTD PMID:32234424 Art3 Mouse ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of ART3 mRNA and [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of ART3 mRNA CTD PMID:27106289 and PMID:34911549 Art3 Mouse paracetamol multiple interactions EXP 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of ART3 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of ART3 mRNA] CTD PMID:17585979 Art3 Mouse paraquat increases expression EXP 6480464 Paraquat results in increased expression of ART3 mRNA CTD PMID:12595580 Art3 Mouse perfluorooctane-1-sulfonic acid increases expression ISO Art3 (Rattus norvegicus) 6480464 perfluorooctane sulfonic acid results in increased expression of ART3 mRNA CTD PMID:22237054 Art3 Mouse perfluorooctanoic acid multiple interactions ISO Art3 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of ART3 mRNA CTD PMID:35163327 Art3 Mouse phorbol 13-acetate 12-myristate multiple interactions EXP 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in increased expression of ART3 mRNA CTD PMID:23519560 Art3 Mouse poly(I:C) multiple interactions ISO Art3 (Rattus norvegicus) 6480464 [Poly I-C co-treated with HU 211] results in increased expression of ART3 mRNA CTD PMID:26923065 Art3 Mouse progesterone multiple interactions ISO ART3 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of ART3 mRNA and [Progesterone co-treated with Estradiol] results in increased expression of ART3 mRNA CTD PMID:17404688 and PMID:20660070 Art3 Mouse progesterone increases expression ISO Art3 (Rattus norvegicus) 6480464 Progesterone results in increased expression of ART3 mRNA CTD PMID:20726854 Art3 Mouse purine-6-thiol increases expression ISO Art3 (Rattus norvegicus) 6480464 Mercaptopurine results in increased expression of ART3 mRNA CTD PMID:23358152 Art3 Mouse sodium arsenite decreases expression ISO ART3 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of ART3 mRNA CTD PMID:29301061 Art3 Mouse sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of ART3 mRNA CTD PMID:37682722 Art3 Mouse sodium dodecyl sulfate increases expression ISO ART3 (Homo sapiens) 6480464 Sodium Dodecyl Sulfate results in increased expression of ART3 mRNA CTD PMID:31734321 Art3 Mouse sodium fluoride increases expression EXP 6480464 Sodium Fluoride results in increased expression of ART3 protein CTD PMID:28918527 Art3 Mouse Soman decreases expression ISO Art3 (Rattus norvegicus) 6480464 Soman results in decreased expression of ART3 mRNA CTD PMID:19281266 Art3 Mouse sulforaphane increases expression EXP 6480464 sulforaphane results in increased expression of ART3 mRNA CTD PMID:30529165 Art3 Mouse tamoxifen affects expression EXP 6480464 Tamoxifen affects the expression of ART3 mRNA CTD PMID:17555576 Art3 Mouse tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of ART3 mRNA CTD PMID:17484886 Art3 Mouse titanium dioxide decreases expression EXP 6480464 titanium dioxide results in decreased expression of ART3 mRNA CTD PMID:23557971 Art3 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of ART3 gene CTD PMID:35295148 Art3 Mouse tributylstannane multiple interactions ISO Art3 (Rattus norvegicus) 6480464 [bisphenol A co-treated with tributyltin] results in increased expression of ART3 mRNA CTD PMID:31129395 Art3 Mouse trichloroethene increases expression ISO Art3 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of ART3 mRNA CTD PMID:33387578 Art3 Mouse triclosan decreases expression ISO ART3 (Homo sapiens) 6480464 Triclosan results in decreased expression of ART3 mRNA CTD PMID:30510588 Art3 Mouse trimellitic anhydride decreases expression EXP 6480464 trimellitic anhydride results in decreased expression of ART3 mRNA CTD PMID:19042947 Art3 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of ART3 mRNA CTD PMID:33045310 Art3 Mouse troglitazone increases expression EXP 6480464 troglitazone results in increased expression of ART3 mRNA CTD PMID:28973697 Art3 Mouse valproic acid decreases methylation ISO ART3 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of ART3 gene CTD PMID:29154799 Art3 Mouse valproic acid affects expression ISO ART3 (Homo sapiens) 6480464 Valproic Acid affects the expression of ART3 mRNA CTD PMID:25979313 Art3 Mouse valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of ART3 mRNA CTD PMID:17963808 Art3 Mouse zinc atom increases expression ISO Art3 (Rattus norvegicus) 6480464 Zinc results in increased expression of ART3 mRNA CTD PMID:17074742 Art3 Mouse zinc sulfate increases expression ISO Art3 (Rattus norvegicus) 6480464 Zinc Sulfate results in increased expression of ART3 mRNA CTD PMID:17074742 Art3 Mouse zinc(0) increases expression ISO Art3 (Rattus norvegicus) 6480464 Zinc results in increased expression of ART3 mRNA CTD PMID:17074742
17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (ISO) 2-palmitoylglycerol (ISO) 3,3',5,5'-tetrabromobisphenol A (EXP) 3,4-methylenedioxymethamphetamine (EXP) 3,7-dihydropurine-6-thione (ISO) 3-methylcholanthrene (EXP) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (EXP) 4-hydroxyphenyl retinamide (EXP) 6-propyl-2-thiouracil (EXP,ISO) acrylamide (EXP,ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (ISO) ammonium chloride (ISO) amphetamine (ISO) arsane (ISO) arsenic atom (ISO) atrazine (ISO) benzalkonium chloride (EXP) benzo[a]pyrene (EXP,ISO) bis(2-ethylhexyl) phthalate (EXP) bisphenol A (EXP,ISO) cadmium dichloride (ISO) cantharidin (EXP) carbon nanotube (EXP) CGP 52608 (ISO) clofibrate (EXP) crocidolite asbestos (EXP) cyclosporin A (ISO) dexamethasone (EXP) dibenz[a,h]anthracene (EXP) diiodine (EXP) diisononyl phthalate (EXP) dioxygen (EXP) diuron (ISO) doxorubicin (ISO) genistein (EXP) ketamine (ISO) lead diacetate (EXP) mercaptopurine (ISO) methimazole (ISO) Monobutylphthalate (EXP) morphine (ISO) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (EXP) nitrofen (ISO) O-methyleugenol (ISO) ozone (EXP) paracetamol (EXP) paraquat (EXP) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) phorbol 13-acetate 12-myristate (EXP) poly(I:C) (ISO) progesterone (ISO) purine-6-thiol (ISO) sodium arsenite (EXP,ISO) sodium dodecyl sulfate (ISO) sodium fluoride (EXP) Soman (ISO) sulforaphane (EXP) tamoxifen (EXP) tetrachloromethane (EXP) titanium dioxide (EXP) tributylstannane (ISO) trichloroethene (ISO) triclosan (ISO) trimellitic anhydride (EXP) triptonide (EXP) troglitazone (EXP) valproic acid (EXP,ISO) zinc atom (ISO) zinc sulfate (ISO) zinc(0) (ISO)
Art3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 92,479,659 - 92,562,487 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 92,479,686 - 92,562,487 (+) Ensembl GRCm39 Ensembl GRCm38 5 92,331,799 - 92,414,628 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 92,331,827 - 92,414,628 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 92,760,867 - 92,843,654 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 93,463,343 - 93,489,822 (+) NCBI MGSCv36 mm8 Celera 5 90,475,638 - 90,563,091 (+) NCBI Celera Cytogenetic Map 5 E2 NCBI cM Map 5 46.54 NCBI
ART3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 4 76,011,190 - 76,112,786 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 4 76,011,184 - 76,114,048 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 4 76,932,343 - 77,033,939 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 4 77,214,887 - 77,252,965 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 4 77,353,041 - 77,391,117 NCBI Celera 4 74,232,860 - 74,334,155 (+) NCBI Celera Cytogenetic Map 4 q21.1 ENTREZGENE HuRef 4 72,684,626 - 72,786,387 (+) NCBI HuRef CHM1_1 4 76,908,897 - 77,010,440 (+) NCBI CHM1_1 T2T-CHM13v2.0 4 79,351,693 - 79,453,452 (+) NCBI T2T-CHM13v2.0
Art3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 15,921,540 - 16,003,764 (-) NCBI GRCr8 mRatBN7.2 14 15,637,230 - 15,719,442 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 15,637,237 - 15,665,407 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 15,645,325 - 15,727,626 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 16,964,175 - 17,046,472 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 15,659,591 - 15,741,911 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 17,143,037 - 17,225,389 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 17,143,040 - 17,225,389 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 17,059,129 - 17,141,549 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 17,198,267 - 17,280,642 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 17,220,238 - 17,220,888 (-) NCBI Celera 14 15,031,682 - 15,113,870 (-) NCBI Celera Cytogenetic Map 14 p22 NCBI
Art3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955433 810,703 - 853,589 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955433 743,631 - 850,612 (+) NCBI ChiLan1.0 ChiLan1.0
ART3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 3 53,960,662 - 54,062,331 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 4 54,150,391 - 54,252,086 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 4 48,093,339 - 48,194,785 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 4 53,931,454 - 54,032,652 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 4 53,931,454 - 53,969,512 (-) Ensembl panpan1.1 panPan2
ART3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 32 563,628 - 742,482 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 32 537,603 - 742,292 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 32 41,140,026 - 41,320,010 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 32 586,777 - 769,084 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 32 560,652 - 769,078 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 32 586,542 - 767,137 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 32 540,864 - 721,424 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 32 39,448,111 - 39,628,887 (-) NCBI UU_Cfam_GSD_1.0
Art3
ART3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 8 71,673,799 - 71,795,343 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 8 71,673,799 - 71,795,332 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 8 75,955,003 - 75,991,009 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ART3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 7 24,505,862 - 24,614,799 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 7 24,577,172 - 24,616,629 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 2,925,230 - 2,962,977 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Art3
.
Predicted Target Of
Count of predictions: 1479 Count of miRNA genes: 535 Interacting mature miRNAs: 629 Transcripts: ENSMUST00000113083, ENSMUST00000117108, ENSMUST00000118106, ENSMUST00000119587, ENSMUST00000120193, ENSMUST00000120416, ENSMUST00000120781, ENSMUST00000121096, ENSMUST00000124509, ENSMUST00000125462, ENSMUST00000126281, ENSMUST00000128246, ENSMUST00000129222, ENSMUST00000135528, ENSMUST00000138003, ENSMUST00000138687, ENSMUST00000145072, ENSMUST00000152041, ENSMUST00000154245 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
4140990 Lgq6_m late growth QTL 6 (mouse) Not determined 32133234 100777931 Mouse 1301010 ahl2_m age related hearing loss 2 (mouse) Not determined 5 62650568 96650688 Mouse 1301399 Cpfd3_m cerebellum pattern fissures (mouse) Not determined 5 87386871 121387065 Mouse 12910784 Pwgrq15_m post-weaning growth rate QTL 15 (mouse) 5 77175823 97658215 Mouse 1301524 Lmb2_m lupus in MRL and B6 F2 cross (mouse) Not determined 5 37581488 112465722 Mouse 25314315 Mlh1fc4_m MLH1 foci count 4 (mouse) 5 74460661 132528839 Mouse 1357725 Eae39_m experimental allergic encephalomyelitis 39 (mouse) Not determined 5 89418876 118864028 Mouse 10045972 Tir5_m trypanosome infection response 5 (mouse) Not determined 5 63705442 104387065 Mouse 1300993 Hycdc_m hypercapnic duty cycle (mouse) Not determined 5 90561006 124561151 Mouse 1301126 Bwem1_m body weight day 30 males 1 (mouse) Not determined 5 87386871 121387065 Mouse 4141219 W10q16_m weight 10 weeks QTL 16 (mouse) Not determined 32133234 100777931 Mouse 12910816 Ogrq2_m overall growth rate QTL 2 (mouse) 5 77175823 97658215 Mouse 1301691 Cdcs10_m cytokine deficiency colitis susceptibility 10 (mouse) Not determined 5 76280786 110280917 Mouse 11041665 Lmr24_m leishmaniasis resistance 24 (mouse) 5 52694462 107321041 Mouse 10043958 Chldq12_m cholesterol and HDL QTL 12 (mouse) Not determined 5 87386871 121387065 Mouse 26884395 Humsd2_m humerus midshaft diameter 2, 10 week (mouse) 5 70057343 132528839 Mouse 11252124 Modvl6_m modifier of vacuolated lens 6 (mouse) 5 62650568 96650688 Mouse 1301419 Cypr3_m cytokine production 3 (mouse) Not determined 5 81019649 115019803 Mouse 11341716 Rvfs3_m Rift Valley fever susceptibility 3 (mouse) 5 26441234 138455402 Mouse 13506928 Recrq8_m recombination rate in male meiosis QTL 8 (mouse) 5 74460661 132528839 Mouse 1301843 Listr1_m listeriosis resistance 1 (mouse) Not determined 5 60246081 94246203 Mouse 10043993 Hbnr10_m Heligmosomoides bakeri nematode resistance 10 (mouse) Not determined 5 72418876 106419011 Mouse 27226719 Tibw6_m tibia width 6, proximal, 16 week (mouse) 5 72857343 139985755 Mouse 10401246 Bglu13_m blood glucose level 13 (mouse) Not determined 5 79539640 113539786 Mouse 4141438 Skmw13_m skeletal muscle weight 13 (mouse) Not determined 5 76190263 110190479 Mouse 1301713 Dbsty2_m diabesity 2 (mouse) Not determined 5 76445064 110445225 Mouse 1301457 Cfsw2_m cystic fibrosis survival to weaning 2 (mouse) Not determined 5 90561006 124561151 Mouse 11041899 Lmr24a_m leishmaniasis resistance 24a (mouse) 5 52694462 107321041 Mouse 10401245 Bglu18_m blood glucose level 18 (mouse) Not determined 5 82838468 116838597 Mouse 4142064 Tmc1m4_m Tmc1 modifier 4 (mouse) Not determined 5 54500177 127001072 Mouse 1300931 Cocrb6_m cocaine related behavior 6 (mouse) Not determined 5 76445064 110445225 Mouse 4142317 Rgcs1_m retinal ganglion cell susceptible 1 (mouse) Not determined 55388334 108762627 Mouse 1300801 Drb2_m dopamine receptor binding 2 (mouse) Not determined 5 87386871 121387065 Mouse 1301829 Thyls2_m thymic lymphoma susceptibility 2 (mouse) Not determined 5 76445064 110445225 Mouse 12904740 M1fscn2_m modifier 1 of Fscn2 (mouse) 5 66529661 100529661 Mouse 10755524 Mono1_m monocyte differential 1 (mouse) 5 80849259 114849259 Mouse 1301362 Prnr1_m prion resistance 1 (mouse) Not determined 5 89418876 146787935 Mouse 4142428 Modvl1_m modifier of vacuolated lens 1 (mouse) Not determined 62650568 96650688 Mouse 1357431 Cia27_m collagen induced arthritis 27 (mouse) Not determined 5 75315348 120018629 Mouse 11040589 Lmr3a_m leishmaniasis resistance 3a (mouse) 5 59602801 93602980 Mouse 11040590 Lmr3b_m leishmaniasis resistance 3b (mouse) 5 59602801 93602980 Mouse 11040591 Lmr3c_m leishmaniasis resistance 3c (mouse) 5 59602801 93602980 Mouse 12904739 M2fscn2_m modifier 2 of FSCN2 (mouse) 5 66529661 100529661 Mouse 1301243 Bmd2_m bone mineral density 2 (mouse) Not determined 5 55388334 100455525 Mouse 1300986 Hdlq2_m HDL QTL 2 (mouse) Not determined 5 76280786 110280917 Mouse 11049560 Lmr24d_m leishmaniasis resistance 24d (mouse) 5 64374877 98374996 Mouse 11049562 Lmr24f_m leishmaniasis resistance 24f (mouse) 5 90320962 124321041 Mouse 13464249 Ahl16_m age related hearing loss, early onset 16 (mouse) 5 76445064 110445225 Mouse 13464250 Ahl15_m age related hearing loss, early onset 15 (mouse) 5 62650568 96650688 Mouse 11040592 Lmr3d_m leishmaniasis resistance 3d (mouse) 5 59602801 93602980 Mouse 13464247 Ahl14_m age related hearing loss, early onset 14 (mouse) 5 60403062 94403160 Mouse 4141124 Dshv2_m dorsal hippocampal volume 2 (mouse) Not determined 5 75315348 98019803 Mouse 1300968 Skts4_m skin tumor susceptibility 4 (mouse) Not determined 5 89418876 124238239 Mouse 13464241 Ahl18_m age related hearing loss, early onset 18 (mouse) 5 87386871 121387065 Mouse 4141505 Chlq14_m circulating hormone level QTL 14 (mouse) Not determined 5 76280786 110280917 Mouse 13464242 Ahl17_m age related hearing loss, early onset 17 (mouse) 5 82838468 116838597 Mouse
AI661308
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 5 92,346,900 - 92,347,014 UniSTS GRCm38 MGSCv37 5 92,775,926 - 92,776,040 UniSTS GRCm37 Celera 5 90,490,696 - 90,490,810 UniSTS Cytogenetic Map 5 E2 UniSTS cM Map 5 53.0 UniSTS cM Map 5 52.0 UniSTS Whitehead/MRC_RH 5 1115.14 UniSTS
M86829
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 5 92,347,070 - 92,347,256 UniSTS GRCm38 MGSCv37 5 92,776,096 - 92,776,282 UniSTS GRCm37 Celera 5 90,490,867 - 90,491,053 UniSTS Cytogenetic Map 5 E2 UniSTS cM Map 5 53.0 UniSTS cM Map 5 52.0 UniSTS Whitehead_YAC 5 UniSTS
Scyb11
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 5 92,360,567 - 92,360,761 UniSTS GRCm38 MGSCv37 5 92,789,593 - 92,789,787 UniSTS GRCm37 Celera 5 90,504,216 - 90,504,410 UniSTS Cytogenetic Map 5 E2 UniSTS Cytogenetic Map 5 E3 UniSTS cM Map 5 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000113083 ⟹ ENSMUSP00000108706
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,479,700 - 92,562,484 (+) Ensembl GRCm38.p6 Ensembl 5 92,331,841 - 92,414,625 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000117108 ⟹ ENSMUSP00000113041
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000118106 ⟹ ENSMUSP00000114083
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000119587 ⟹ ENSMUSP00000112648
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,482 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,623 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000120193 ⟹ ENSMUSP00000113074
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000120416 ⟹ ENSMUSP00000113493
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000120781 ⟹ ENSMUSP00000113008
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,524,834 - 92,540,905 (+) Ensembl GRCm38.p6 Ensembl 5 92,376,975 - 92,393,046 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000121096 ⟹ ENSMUSP00000113510
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,479,700 - 92,562,487 (+) Ensembl GRCm38.p6 Ensembl 5 92,331,841 - 92,414,628 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000124509 ⟹ ENSMUSP00000119113
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,535,710 - 92,540,835 (+) Ensembl GRCm38.p6 Ensembl 5 92,387,851 - 92,392,976 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000125462 ⟹ ENSMUSP00000117995
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,479,689 - 92,540,990 (+) Ensembl GRCm38.p6 Ensembl 5 92,331,830 - 92,393,131 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000126281 ⟹ ENSMUSP00000116110
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,540,444 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,392,585 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000128246 ⟹ ENSMUSP00000121620
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,534,746 - 92,540,876 (+) Ensembl GRCm38.p6 Ensembl 5 92,386,887 - 92,393,017 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000129222
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,536,002 - 92,562,481 (+) Ensembl GRCm38.p6 Ensembl 5 92,388,143 - 92,414,622 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000135528
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,479,700 - 92,494,629 (+) Ensembl GRCm38.p6 Ensembl 5 92,331,841 - 92,346,770 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000138003 ⟹ ENSMUSP00000123571
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,540,918 - 92,562,482 (+) Ensembl GRCm38.p6 Ensembl 5 92,393,059 - 92,414,623 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000138687 ⟹ ENSMUSP00000118746
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,535,705 - 92,540,454 (+) Ensembl GRCm38.p6 Ensembl 5 92,387,846 - 92,392,595 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000145072 ⟹ ENSMUSP00000116218
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,535,622 - 92,540,584 (+) Ensembl GRCm38.p6 Ensembl 5 92,387,763 - 92,392,725 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000152041 ⟹ ENSMUSP00000114826
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,549,857 - 92,562,306 (+) Ensembl GRCm38.p6 Ensembl 5 92,401,998 - 92,414,447 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000154245 ⟹ ENSMUSP00000119283
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 92,479,686 - 92,540,793 (+) Ensembl GRCm38.p6 Ensembl 5 92,331,827 - 92,392,934 (+) Ensembl
RefSeq Acc Id:
NM_001310664 ⟹ NP_001297593
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,686 - 92,562,487 (+) NCBI GRCm38 5 92,331,827 - 92,414,628 (+) NCBI
Sequence:
GGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGCTGCCTGCACTGATCTGCTGAAGAAAAGAAGCACTTTAGGGAAGAAAGAGGGGAAGTTTCTCCCAAATTGAAACTCGTGTGCTCGTTTTA
hide sequence
RefSeq Acc Id:
NM_001310665 ⟹ NP_001297594
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,993 - 92,562,487 (+) NCBI GRCm38 5 92,388,134 - 92,414,628 (+) NCBI
Sequence:
ACGTGAAAAATGAAGATGGGACATTTTGAAATGGTCACCACGCTGCTGGCAGCCGCAGTTCTAATGGACATCTTCCAGGTGAAGGCGGAAGTGTTAGACATGGCAGAGAACGCGTTTGACGACGAATA
hide sequence
RefSeq Acc Id:
NM_001370591 ⟹ NP_001357520
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,746 - 92,562,487 (+) NCBI GRCm38 5 92,386,887 - 92,414,628 (+) NCBI
Sequence:
ACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGA
hide sequence
RefSeq Acc Id:
NM_181728 ⟹ NP_859417
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,993 - 92,562,487 (+) NCBI GRCm38 5 92,388,134 - 92,414,628 (+) NCBI MGSCv37 5 92,760,867 - 92,843,654 (+) RGD Celera 5 90,475,638 - 90,563,091 (+) RGD cM Map 5 ENTREZGENE
Sequence:
ACGTGAAAAATGAAGATGGGACATTTTGAAATGGTCACCACGCTGCTGGCAGCCGCAGTTCTAA
hide sequence
RefSeq Acc Id:
XM_006534706 ⟹ XP_006534769
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAAC
hide sequence
RefSeq Acc Id:
XM_006534707 ⟹ XP_006534770
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,659 - 92,562,487 (+) NCBI GRCm38 5 92,331,799 - 92,414,628 (+) NCBI
Sequence:
GTTTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGCTGCCTGCACTGATCTGCTGAAGAAAAGAAGCACTTTAGGGAAGAAAGAGGGGAAGTTTCTCC
hide sequence
RefSeq Acc Id:
XM_006534708 ⟹ XP_006534771
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,659 - 92,562,487 (+) NCBI GRCm38 5 92,331,799 - 92,414,628 (+) NCBI
Sequence:
GTTTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGG
hide sequence
RefSeq Acc Id:
XM_006534709 ⟹ XP_006534772
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,569 - 92,562,487 (+) NCBI GRCm38 5 92,387,707 - 92,414,628 (+) NCBI
Sequence:
AAAGCGAACGGAAGAGCGGAAGCTTCACATGGGAAAGTTTCTAGACCATTCTTAGAAACTGGGA
hide sequence
RefSeq Acc Id:
XM_006534710 ⟹ XP_006534773
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,519,547 - 92,562,487 (+) NCBI GRCm38 5 92,371,682 - 92,414,628 (+) NCBI
Sequence:
AACGAGGCAGCCTCGGACAAGGGAGAGGGTCGGGGAAGCAGATGTGGGTGACACCACTCCTGGT
hide sequence
RefSeq Acc Id:
XM_006534711 ⟹ XP_006534774
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,480 - 92,562,487 (+) NCBI GRCm38 5 92,387,598 - 92,414,628 (+) NCBI
Sequence:
GAGGAGGGAGGTCACCTCAGGCGAACAGCTTTGTACTGCTGCTGACCTCATGTCTCCGCTCCCACCCAAGTGGGCATGCTCTAACTTGCAAAGCGAACGGAAGAGCGGAAGCTTCACATGGACGTGAA
hide sequence
RefSeq Acc Id:
XM_006534712 ⟹ XP_006534775
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,659 - 92,562,487 (+) NCBI GRCm38 5 92,331,799 - 92,414,628 (+) NCBI
Sequence:
GTTTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGG
hide sequence
RefSeq Acc Id:
XM_006534713 ⟹ XP_006534776
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAAC
hide sequence
RefSeq Acc Id:
XM_006534714 ⟹ XP_006534777
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGACAGGGCATC
hide sequence
RefSeq Acc Id:
XM_006534716 ⟹ XP_006534779
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAAC
hide sequence
RefSeq Acc Id:
XM_006534718 ⟹ XP_006534781
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGACAGGGCATC
hide sequence
RefSeq Acc Id:
XM_006534719 ⟹ XP_006534782
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGACAGGGCATC
hide sequence
RefSeq Acc Id:
XM_006534720 ⟹ XP_006534783
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,185 (+) NCBI GRCm38 5 92,386,832 - 92,414,326 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGACAGGGCATC
hide sequence
RefSeq Acc Id:
XM_006534721 ⟹ XP_006534784
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,482 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAACAACATCCTATCCTGGAGGGAAGTTCTCCACAGCAGAGTGGGAATCCGGTGTGAGACAGGGCATC
hide sequence
RefSeq Acc Id:
XM_030254048 ⟹ XP_030109908
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,660 - 92,562,487 (+) NCBI GRCm38 5 92,331,801 - 92,414,628 (+) NCBI
Sequence:
TTTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGCTGCCTGCACTGATCTGCTGAAGAAAAGAAGCACTTTAGGGAAGAAAGTGTCTGGACTCTCCTC
hide sequence
RefSeq Acc Id:
XM_030254049 ⟹ XP_030109909
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,528 - 92,562,487 (+) NCBI GRCm38 5 92,387,608 - 92,414,628 (+) NCBI
Sequence:
CATGTCTCCGCTCCCACCCAAGTGGGCATGCTCTAACTTGCAAAGCGAACGGAAGAGCGGAAGC
hide sequence
RefSeq Acc Id:
XM_030254050 ⟹ XP_030109910
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,691 - 92,562,487 (+) NCBI GRCm38 5 92,386,832 - 92,414,628 (+) NCBI
Sequence:
ACTGCCAAGCTACCACTAGGGGTGTTATAAAAAGAAAAGCATTCCCAGGCAGCTCACTGTCAAC
hide sequence
RefSeq Acc Id:
XM_030254051 ⟹ XP_030109911
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,661 - 92,562,487 (+) NCBI GRCm38 5 92,331,801 - 92,414,628 (+) NCBI
Sequence:
TTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGCTGCCTGCACTGATCTGCTGAAGAAAAGAAGCACTTTAGGGAAGAAAGAGGGGAAGTTTCTCCCA
hide sequence
RefSeq Acc Id:
XM_030254052 ⟹ XP_030109912
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,661 - 92,562,487 (+) NCBI GRCm38 5 92,331,801 - 92,414,628 (+) NCBI
Sequence:
TTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGCTGCCTGCACTGATCTGCTGAAGAAAAGAAGCACTTTAGGGAAGAAAGTGTCTGGACTCTCCTCT
hide sequence
RefSeq Acc Id:
XM_030254053 ⟹ XP_030109913
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,519,542 - 92,562,487 (+) NCBI GRCm38 5 92,371,683 - 92,414,628 (+) NCBI
Sequence:
TCAGTAACGAGGCAGCCTCGGACAAGGGAGAGGGTCGGGGAAGCAGATGTGGGTGACACCACTC
hide sequence
RefSeq Acc Id:
XM_030254054 ⟹ XP_030109914
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,479,661 - 92,562,487 (+) NCBI GRCm38 5 92,331,801 - 92,414,628 (+) NCBI
Sequence:
TTGCTTCCAGAACTTTCCTCCACCCGGAGCTCAACGCTCACTCTACGCGTGTAGCTGCTGGGGC
hide sequence
RefSeq Acc Id:
XM_036164728 ⟹ XP_036020621
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,535,571 - 92,562,487 (+) NCBI
Sequence:
AGCGAACGGAAGAGCGGAAGCTTCACATGGGAAAGTTTCTAGACCATTCTTAGAAACTGGGAGTGAGAATGAGAGCATGGTGGTTTTAGTTTGTGTTGTTTCCTACGTGAAAAATGAAGATGGGACAT
hide sequence
RefSeq Acc Id:
XM_036164729 ⟹ XP_036020622
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 92,534,582 - 92,562,487 (+) NCBI
Sequence:
TGTGGATTCACAGACCTCTTGGAGACTTAGTGTTAACAGCAGTGGTTCCAGGGCAGAGTGTGGC
hide sequence
RefSeq Acc Id:
NP_859417 ⟸ NM_181728
- Peptide Label:
isoform 2 precursor
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534770 ⟸ XM_006534707
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534771 ⟸ XM_006534708
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534775 ⟸ XM_006534712
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534773 ⟸ XM_006534710
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534776 ⟸ XM_006534713
- Peptide Label:
isoform X2
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534779 ⟸ XM_006534716
- Peptide Label:
isoform X4
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534783 ⟸ XM_006534720
- Peptide Label:
isoform X9
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534769 ⟸ XM_006534706
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534777 ⟸ XM_006534714
- Peptide Label:
isoform X3
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL), E9QNU1 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534782 ⟸ XM_006534719
- Peptide Label:
isoform X8
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534784 ⟸ XM_006534721
- Peptide Label:
isoform X11
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534781 ⟸ XM_006534718
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534774 ⟸ XM_006534711
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_006534772 ⟸ XM_006534709
- Peptide Label:
isoform X1
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
NP_001297593 ⟸ NM_001310664
- Peptide Label:
isoform 1 precursor
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL), E9QNU1 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
NP_001297594 ⟸ NM_001310665
- Peptide Label:
isoform 3 precursor
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
- Sequence:
MKMGHFEMVTTLLAAAVLMDIFQVKAEVLDMAENAFDDEYLKCKSRMESKYIPQMKREEWANDALLRMVWDNAEIQWEARKAQLFLPRNFKDTYGIALTAYVNEAQEQTSFYHTFSSAVKMAGLSRRR
hide sequence
RefSeq Acc Id:
XP_030109911 ⟸ XM_030254051
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109908 ⟸ XM_030254048
- Peptide Label:
isoform X5
- UniProtKB:
Q8R2F9 (UniProtKB/Swiss-Prot), O54738 (UniProtKB/Swiss-Prot), B2RUC2 (UniProtKB/Swiss-Prot), Q8R2G4 (UniProtKB/Swiss-Prot), Q8R2G3 (UniProtKB/Swiss-Prot), Q8R2G2 (UniProtKB/Swiss-Prot), Q8R2G1 (UniProtKB/Swiss-Prot), Q8R2G0 (UniProtKB/Swiss-Prot), B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109912 ⟸ XM_030254052
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109914 ⟸ XM_030254054
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109913 ⟸ XM_030254053
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109910 ⟸ XM_030254050
- Peptide Label:
isoform X6
- UniProtKB:
A0A0R4J1Q4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001357520 ⟸ NM_001370591
- Peptide Label:
isoform 4 precursor
- UniProtKB:
Q8R2G4 (UniProtKB/Swiss-Prot), Q8R2G3 (UniProtKB/Swiss-Prot), Q8R2G2 (UniProtKB/Swiss-Prot), Q8R2G1 (UniProtKB/Swiss-Prot), Q8R2G0 (UniProtKB/Swiss-Prot), Q8R2F9 (UniProtKB/Swiss-Prot), O54738 (UniProtKB/Swiss-Prot), B2RUC2 (UniProtKB/Swiss-Prot), B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_030109909 ⟸ XM_030254049
- Peptide Label:
isoform X5
- UniProtKB:
Q8R2G4 (UniProtKB/Swiss-Prot), Q8R2G3 (UniProtKB/Swiss-Prot), Q8R2G2 (UniProtKB/Swiss-Prot), Q8R2G1 (UniProtKB/Swiss-Prot), Q8R2G0 (UniProtKB/Swiss-Prot), Q8R2F9 (UniProtKB/Swiss-Prot), O54738 (UniProtKB/Swiss-Prot), B2RUC2 (UniProtKB/Swiss-Prot), B7ZNM3 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSMUSP00000117995 ⟸ ENSMUST00000125462
Ensembl Acc Id:
ENSMUSP00000116218 ⟸ ENSMUST00000145072
Ensembl Acc Id:
ENSMUSP00000112648 ⟸ ENSMUST00000119587
Ensembl Acc Id:
ENSMUSP00000119113 ⟸ ENSMUST00000124509
Ensembl Acc Id:
ENSMUSP00000118746 ⟸ ENSMUST00000138687
Ensembl Acc Id:
ENSMUSP00000114083 ⟸ ENSMUST00000118106
Ensembl Acc Id:
ENSMUSP00000123571 ⟸ ENSMUST00000138003
Ensembl Acc Id:
ENSMUSP00000108706 ⟸ ENSMUST00000113083
Ensembl Acc Id:
ENSMUSP00000114826 ⟸ ENSMUST00000152041
Ensembl Acc Id:
ENSMUSP00000116110 ⟸ ENSMUST00000126281
Ensembl Acc Id:
ENSMUSP00000113510 ⟸ ENSMUST00000121096
Ensembl Acc Id:
ENSMUSP00000113008 ⟸ ENSMUST00000120781
Ensembl Acc Id:
ENSMUSP00000119283 ⟸ ENSMUST00000154245
Ensembl Acc Id:
ENSMUSP00000113493 ⟸ ENSMUST00000120416
Ensembl Acc Id:
ENSMUSP00000113074 ⟸ ENSMUST00000120193
Ensembl Acc Id:
ENSMUSP00000121620 ⟸ ENSMUST00000128246
Ensembl Acc Id:
ENSMUSP00000113041 ⟸ ENSMUST00000117108
RefSeq Acc Id:
XP_036020622 ⟸ XM_036164729
- Peptide Label:
isoform X10
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_036020621 ⟸ XM_036164728
- Peptide Label:
isoform X7
- UniProtKB:
B7ZNM3 (UniProtKB/TrEMBL)
RGD ID: 6887176 Promoter ID: EPDNEW_M7039 Type: single initiation site Name: Art3_2 Description: Mus musculus ADP-ribosyltransferase 3 , transcript variant 3,mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M7041 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 5 92,353,483 - 92,353,543 EPDNEW
RGD ID: 6887180 Promoter ID: EPDNEW_M7041 Type: multiple initiation site Name: Art3_1 Description: Mus musculus ADP-ribosyltransferase 3 , transcript variant 3,mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M7039 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 5 92,386,887 - 92,386,947 EPDNEW
