Symbol:
Tex2
Name:
testis expressed gene 2
RGD ID:
1312952
MGI Page
MGI
Description:
Predicted to enable lipid binding activity. Predicted to be involved in lipid transport. Predicted to be located in endoplasmic reticulum membrane and nuclear membrane. Predicted to be active in endoplasmic reticulum. Is expressed in several structures, including alimentary system; genitourinary system; hemolymphoid system; nervous system; and respiratory system. Orthologous to human TEX2 (testis expressed 2).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
4930568E07Rik; AI553404; Def-5; Taz; Taz4; testis-expressed protein 2; testis-expressed sequence 2 protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TEX2 (testis expressed 2) HGNC
Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Tex2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tex2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TEX2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TEX2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tex2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TEX2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TEX2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tex2 (testis expressed 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Tex2 (testis expressed 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
TEX2 (testis expressed 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tex2 (testis expressed 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
F55C12.5
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
CG43783
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
NVJ2
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tex2.2
Alliance
DIOPT (Hieranoid|OrthoFinder|OrthoInspector|PANTHER)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 106,392,965 - 106,504,259 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 106,392,973 - 106,504,249 (-) Ensembl GRCm39 Ensembl GRCm38 11 106,502,139 - 106,613,433 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 106,502,147 - 106,613,423 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 106,363,453 - 106,474,244 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 106,318,229 - 106,429,020 (-) NCBI MGSCv36 mm8 Celera 11 118,233,526 - 118,344,699 (-) NCBI Celera Cytogenetic Map 11 E1 NCBI cM Map 11 69.46 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tex2 Mouse (-)-epigallocatechin 3-gallate multiple interactions ISO TEX2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of TEX2 mRNA CTD PMID:22079256 Tex2 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TEX2 mRNA CTD PMID:22206623 Tex2 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of TEX2 mRNA CTD PMID:22206623 Tex2 Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of TEX2 mRNA CTD PMID:19484750 Tex2 Mouse 17beta-estradiol increases expression ISO TEX2 (Homo sapiens) 6480464 Estradiol results in increased expression of TEX2 mRNA CTD PMID:31614463 Tex2 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TEX2 mRNA CTD PMID:39298647 Tex2 Mouse 17beta-estradiol multiple interactions ISO Tex2 (Rattus norvegicus) 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of TEX2 mRNA CTD PMID:26496021 Tex2 Mouse 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO TEX2 (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of TEX2 mRNA CTD PMID:29581250 Tex2 Mouse 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tex2 Mouse 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO Tex2 (Rattus norvegicus) 6480464 2 more ... CTD PMID:31826744 Tex2 Mouse 2,2',5,5'-tetrachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tex2 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of TEX2 mRNA CTD PMID:21570461 Tex2 Mouse 2,4-dinitrotoluene affects expression ISO Tex2 (Rattus norvegicus) 6480464 2 and 4-dinitrotoluene affects the expression of TEX2 mRNA CTD PMID:21346803 Tex2 Mouse 2,6-dinitrotoluene affects expression ISO Tex2 (Rattus norvegicus) 6480464 2 and 6-dinitrotoluene affects the expression of TEX2 mRNA CTD PMID:21346803 Tex2 Mouse 2-hydroxypropanoic acid decreases expression ISO TEX2 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of TEX2 mRNA CTD PMID:30851411 Tex2 Mouse 2-methylcholine affects expression ISO TEX2 (Homo sapiens) 6480464 beta-methylcholine affects the expression of TEX2 mRNA CTD PMID:21179406 Tex2 Mouse 3,3',4,4',5-pentachlorobiphenyl decreases expression ISO Tex2 (Rattus norvegicus) 6480464 3 more ... CTD PMID:32119087 Tex2 Mouse 4,4'-sulfonyldiphenol decreases methylation ISO TEX2 (Homo sapiens) 6480464 bisphenol S results in decreased methylation of TEX2 gene CTD PMID:31601247 Tex2 Mouse 4,4'-sulfonyldiphenol affects methylation EXP 6480464 bisphenol S affects the methylation of TEX2 gene CTD PMID:31683443 Tex2 Mouse aflatoxin B1 decreases methylation ISO TEX2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of TEX2 gene CTD PMID:27153756 Tex2 Mouse Aflatoxin B2 alpha increases methylation ISO TEX2 (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of TEX2 intron CTD PMID:30157460 Tex2 Mouse all-trans-retinoic acid increases expression ISO TEX2 (Homo sapiens) 6480464 Tretinoin results in increased expression of TEX2 mRNA CTD PMID:21934132 Tex2 Mouse aristolochic acid A decreases expression ISO TEX2 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of TEX2 mRNA CTD PMID:33212167 Tex2 Mouse arsane multiple interactions ISO TEX2 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TEX2 mRNA CTD PMID:39836092 Tex2 Mouse arsenic atom multiple interactions ISO TEX2 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TEX2 mRNA CTD PMID:39836092 Tex2 Mouse arsenite(3-) decreases expression EXP 6480464 arsenite results in decreased expression of TEX2 protein CTD PMID:37955338 Tex2 Mouse arsenite(3-) multiple interactions ISO TEX2 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to TEX2 mRNA] CTD PMID:32406909 Tex2 Mouse benzo[a]pyrene multiple interactions EXP 6480464 AHR protein affects the reaction [Benzo(a)pyrene affects the expression of TEX2 mRNA] CTD PMID:22228805 Tex2 Mouse benzo[a]pyrene increases methylation ISO TEX2 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of TEX2 promoter CTD PMID:27901495 Tex2 Mouse benzo[a]pyrene affects methylation ISO TEX2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TEX2 3' UTR and Benzo(a)pyrene affects the methylation of TEX2 5' UTR CTD PMID:27901495 Tex2 Mouse benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of TEX2 mRNA CTD PMID:22228805 Tex2 Mouse benzo[a]pyrene diol epoxide I decreases expression ISO TEX2 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Tex2 Mouse benzo[e]pyrene increases methylation ISO TEX2 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of TEX2 intron CTD PMID:30157460 Tex2 Mouse beta-lapachone increases expression ISO TEX2 (Homo sapiens) 6480464 beta-lapachone results in increased expression of TEX2 mRNA CTD PMID:38218311 Tex2 Mouse bis(2-ethylhexyl) phthalate increases expression ISO TEX2 (Homo sapiens) 6480464 Diethylhexyl Phthalate results in increased expression of TEX2 mRNA CTD PMID:31163220 Tex2 Mouse bisphenol A multiple interactions ISO Tex2 (Rattus norvegicus) 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of TEX2 mRNA CTD PMID:26496021 Tex2 Mouse bisphenol A decreases expression ISO Tex2 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of TEX2 mRNA CTD PMID:30816183 Tex2 Mouse bisphenol A affects expression ISO Tex2 (Rattus norvegicus) 6480464 bisphenol A affects the expression of TEX2 mRNA CTD PMID:25181051 Tex2 Mouse bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of TEX2 mRNA CTD PMID:38685157 Tex2 Mouse caffeine affects phosphorylation ISO TEX2 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of TEX2 protein CTD PMID:35688186 Tex2 Mouse CGP 52608 multiple interactions ISO TEX2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to TEX2 gene] CTD PMID:28238834 Tex2 Mouse copper(II) sulfate decreases expression ISO TEX2 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of TEX2 mRNA CTD PMID:19549813 Tex2 Mouse coumarin affects phosphorylation ISO TEX2 (Homo sapiens) 6480464 coumarin affects the phosphorylation of TEX2 protein CTD PMID:35688186 Tex2 Mouse cyclosporin A decreases expression ISO TEX2 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of TEX2 mRNA CTD PMID:20106945 and PMID:25562108 Tex2 Mouse DDE decreases expression ISO TEX2 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of TEX2 mRNA CTD PMID:38568856 Tex2 Mouse epoxiconazole increases expression EXP 6480464 epoxiconazole results in increased expression of TEX2 mRNA CTD PMID:35436446 Tex2 Mouse ethanol affects splicing EXP 6480464 Ethanol affects the splicing of TEX2 mRNA CTD PMID:30319688 Tex2 Mouse fipronil increases expression ISO Tex2 (Rattus norvegicus) 6480464 fipronil results in increased expression of TEX2 mRNA CTD PMID:23962444 Tex2 Mouse flutamide increases expression ISO Tex2 (Rattus norvegicus) 6480464 Flutamide results in increased expression of TEX2 mRNA CTD PMID:24136188 Tex2 Mouse folic acid multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TEX2 mRNA CTD PMID:22206623 Tex2 Mouse folic acid decreases expression EXP 6480464 Folic Acid results in decreased expression of TEX2 mRNA CTD PMID:25629700 Tex2 Mouse FR900359 affects phosphorylation ISO TEX2 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of TEX2 protein CTD PMID:37730182 Tex2 Mouse gentamycin increases expression ISO Tex2 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of TEX2 mRNA CTD PMID:33387578 Tex2 Mouse glafenine decreases expression ISO Tex2 (Rattus norvegicus) 6480464 Glafenine results in decreased expression of TEX2 mRNA CTD PMID:24136188 Tex2 Mouse methapyrilene increases methylation ISO TEX2 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of TEX2 intron CTD PMID:30157460 Tex2 Mouse methidathion increases expression EXP 6480464 methidathion results in increased expression of TEX2 mRNA CTD PMID:34813904 Tex2 Mouse methoxychlor affects methylation ISO Tex2 (Rattus norvegicus) 6480464 Methoxychlor affects the methylation of TEX2 gene CTD PMID:35440735 Tex2 Mouse N-methyl-4-phenylpyridinium decreases expression ISO Tex2 (Rattus norvegicus) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of TEX2 mRNA CTD PMID:28801915 Tex2 Mouse nimesulide increases expression ISO Tex2 (Rattus norvegicus) 6480464 nimesulide results in increased expression of TEX2 mRNA CTD PMID:24136188 Tex2 Mouse paracetamol increases expression ISO Tex2 (Rattus norvegicus) 6480464 Acetaminophen results in increased expression of TEX2 mRNA CTD PMID:33387578 Tex2 Mouse PCB138 multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tex2 Mouse pentachlorophenol decreases expression EXP 6480464 Pentachlorophenol results in decreased expression of TEX2 mRNA CTD PMID:23892564 Tex2 Mouse potassium chromate multiple interactions ISO TEX2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of TEX2 mRNA CTD PMID:22079256 Tex2 Mouse potassium chromate decreases expression ISO TEX2 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of TEX2 mRNA CTD PMID:22079256 Tex2 Mouse potassium dichromate increases expression EXP 6480464 Potassium Dichromate results in increased expression of TEX2 mRNA CTD PMID:23608068 Tex2 Mouse rac-lactic acid decreases expression ISO TEX2 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of TEX2 mRNA CTD PMID:30851411 Tex2 Mouse sodium arsenite multiple interactions ISO TEX2 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TEX2 mRNA CTD PMID:39836092 Tex2 Mouse sodium dichromate decreases expression ISO Tex2 (Rattus norvegicus) 6480464 sodium bichromate results in decreased expression of TEX2 mRNA CTD PMID:25993096 Tex2 Mouse tetrachloromethane decreases expression ISO Tex2 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in decreased expression of TEX2 mRNA CTD PMID:31150632 Tex2 Mouse thioacetamide decreases expression ISO Tex2 (Rattus norvegicus) 6480464 Thioacetamide results in decreased expression of TEX2 mRNA CTD PMID:23411599 and PMID:34492290 Tex2 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of TEX2 gene CTD PMID:35295148 Tex2 Mouse trichostatin A affects expression ISO TEX2 (Homo sapiens) 6480464 trichostatin A affects the expression of TEX2 mRNA CTD PMID:28542535 Tex2 Mouse triphenyl phosphate affects expression ISO TEX2 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of TEX2 mRNA CTD PMID:37042841 Tex2 Mouse valdecoxib increases expression ISO Tex2 (Rattus norvegicus) 6480464 valdecoxib results in increased expression of TEX2 mRNA CTD PMID:24136188 Tex2 Mouse valproic acid increases expression ISO TEX2 (Homo sapiens) 6480464 Valproic Acid results in increased expression of TEX2 mRNA CTD PMID:23179753 and PMID:28001369 Tex2 Mouse valproic acid affects expression ISO TEX2 (Homo sapiens) 6480464 Valproic Acid affects the expression of TEX2 mRNA CTD PMID:25979313 Tex2 Mouse valproic acid decreases methylation ISO TEX2 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of TEX2 gene CTD PMID:29154799
(-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (EXP) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,4-dinitrotoluene (ISO) 2,6-dinitrotoluene (ISO) 2-hydroxypropanoic acid (ISO) 2-methylcholine (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (EXP,ISO) benzo[a]pyrene (EXP,ISO) benzo[a]pyrene diol epoxide I (ISO) benzo[e]pyrene (ISO) beta-lapachone (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (ISO) bisphenol F (EXP) caffeine (ISO) CGP 52608 (ISO) copper(II) sulfate (ISO) coumarin (ISO) cyclosporin A (ISO) DDE (ISO) epoxiconazole (EXP) ethanol (EXP) fipronil (ISO) flutamide (ISO) folic acid (EXP) FR900359 (ISO) gentamycin (ISO) glafenine (ISO) methapyrilene (ISO) methidathion (EXP) methoxychlor (ISO) N-methyl-4-phenylpyridinium (ISO) nimesulide (ISO) paracetamol (ISO) PCB138 (EXP) pentachlorophenol (EXP) potassium chromate (ISO) potassium dichromate (EXP) rac-lactic acid (ISO) sodium arsenite (ISO) sodium dichromate (ISO) tetrachloromethane (ISO) thioacetamide (ISO) titanium dioxide (EXP) trichostatin A (ISO) triphenyl phosphate (ISO) valdecoxib (ISO) valproic acid (ISO)
Tex2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 106,392,965 - 106,504,259 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 106,392,973 - 106,504,249 (-) Ensembl GRCm39 Ensembl GRCm38 11 106,502,139 - 106,613,433 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 106,502,147 - 106,613,423 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 106,363,453 - 106,474,244 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 106,318,229 - 106,429,020 (-) NCBI MGSCv36 mm8 Celera 11 118,233,526 - 118,344,699 (-) NCBI Celera Cytogenetic Map 11 E1 NCBI cM Map 11 69.46 NCBI
TEX2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 64,147,227 - 64,263,260 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 64,147,227 - 64,263,260 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 62,224,587 - 62,340,620 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 59,578,527 - 59,694,385 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 17 56,612,865 - 56,728,752 (-) NCBI Celera Cytogenetic Map 17 q23.3 NCBI HuRef 17 57,594,357 - 57,661,181 (-) NCBI HuRef CHM1_1 17 62,289,265 - 62,405,067 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 65,016,989 - 65,133,047 (-) NCBI T2T-CHM13v2.0
Tex2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 91,936,390 - 92,046,360 (-) NCBI GRCr8 mRatBN7.2 10 91,436,629 - 91,546,240 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 91,436,694 - 91,546,270 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 10 94,697,962 - 94,807,544 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 94,697,016 - 94,807,499 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 94,445,950 - 94,555,519 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 95,938,743 - 96,002,144 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 95,905,940 - 96,015,250 (+) NCBI Celera 10 90,109,290 - 90,217,866 (-) NCBI Celera Cytogenetic Map 10 q32.1 NCBI
Tex2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955478 7,616,196 - 7,691,871 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955478 7,616,196 - 7,689,136 (+) NCBI ChiLan1.0 ChiLan1.0
TEX2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 80,331,559 - 80,450,100 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 85,151,844 - 85,267,747 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 58,242,265 - 58,358,154 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 63,336,296 - 63,452,677 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 63,336,296 - 63,419,494 (-) Ensembl panpan1.1 panPan2
TEX2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 12,024,134 - 12,124,759 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 12,025,666 - 12,082,477 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 12,920,574 - 13,022,327 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 13,687,080 - 13,788,841 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 13,687,083 - 13,788,833 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 12,633,814 - 12,735,329 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 14,797,523 - 14,898,481 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 14,799,104 - 14,900,649 (+) NCBI UU_Cfam_GSD_1.0
Tex2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 14,335,387 - 14,471,831 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936541 4,722,329 - 4,789,564 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936541 4,722,767 - 4,789,514 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TEX2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 14,764,508 - 14,869,217 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 14,764,454 - 14,866,779 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 14,758,851 - 14,861,340 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TEX2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 57,014,054 - 57,127,351 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 57,014,123 - 57,128,821 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 27,625,560 - 27,738,995 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tex2
.
Predicted Target Of
Count of predictions: 940 Count of miRNA genes: 603 Interacting mature miRNAs: 709 Transcripts: ENSMUST00000042780, ENSMUST00000103070, ENSMUST00000128933, ENSMUST00000153870 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1302034 Pkccl_m protein kinase C content in lungs (mouse) Not determined 11 91604608 121973369 Mouse 1301012 Vispl_m visual placing (mouse) Not determined 11 101022590 121973369 Mouse 4141367 Inf1_m acute ozone induced inflammation (mouse) Not determined 44630038 113058009 Mouse 1301535 Pas5b_m pulmonary adenoma susceptibility 5b (mouse) Not determined 11 96176465 108806384 Mouse 1300766 Skull16_m skull morphology 16 (mouse) Not determined 11 81574481 115574636 Mouse 12910539 Sstapa3_m suseptibility to Staphylococcus aureus infection 3 (mouse) 11 96897693 110603991 Mouse 4141612 Cia40_m collagen induced arthritis 40 (mouse) Not determined 11 103273992 115021444 Mouse 4142121 Tmc1m2_m Tmc1 modifier 2 (mouse) Not determined 11 56864027 114157957 Mouse 14747003 Mancz9_m mandible centroid size 9 (mouse) 11 85844911 119844911 Mouse 1301640 Lore4_m loss of righting induced by ethanol 4 (mouse) Not determined 11 79156009 107616472 Mouse 10412288 Carg4_m Candida albicans resistance gene 4 (mouse) Not determined 11 81810267 115810267 Mouse 11251723 Ewc5_m ethanol withdrawal and consumption 5 (mouse) 11 89869251 121973369 Mouse 10413882 Moe1_m modifier of epilepsy 1 (mouse) 11 77770978 111771099 Mouse 4141465 Dbm2_m diabetes modifier 2 (mouse) Not determined 94437183 118022724 Mouse 10045617 Heal26_m wound healing/regeneration 26 (mouse) Not determined 11 92939373 112544554 Mouse 10045616 Heal25_m wound healing/regeneration 25 (mouse) Not determined 11 77437183 111437322 Mouse 1301310 Tmevd5_m Theiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse) Not determined 11 72726125 106726289 Mouse 4142348 Pstc2_m periosteal circumference 2 (mouse) Not determined 11 72818615 106818733 Mouse 11341721 Rvfs2_m Rift Valley fever susceptibility 2 (mouse) 11 100254186 120887165 Mouse 1301414 Heal10_m wound healing/regeneration 10 (mouse) Not determined 11 77437183 111437322 Mouse 1300649 Crhq1_m compensatory renal hypertrophy QTL 1 (mouse) Not determined 11 81574481 115574636 Mouse 27226789 Feml16_m femur length 16, 10 week (mouse) 11 87490826 121873369 Mouse 14746970 Manh71_m mandible shape 71 (mouse) 11 79416257 113416257 Mouse 39128214 Lwq20_m liver weight QTL 20 (mouse) 11 12268637 118022724 Mouse 10043866 Adip19_m adiposity 19 (mouse) Not determined 11 72818615 106818733 Mouse 1301072 Eae22_m experimental allergic encephalomyelitis 22 (mouse) Not determined 11 82377698 116377820 Mouse 1300944 Alcp20_m alcohol preference locus 20 (mouse) Not determined 11 95403965 121973369 Mouse 4141939 Pregq2_m pregnancy QTL 2 (mouse) Not determined 11 94063779 118022724 Mouse 1301983 Berr2_m berghei resistance locus 2 (mouse) Not determined 11 98352609 121973369 Mouse 1300957 Pbd1_m peak bone density 1 (mouse) Not determined 11 102344123 112384123 Mouse 11038695 Par8_m pulmonary adenoma resistance 8 (mouse) 11 77063779 111063918 Mouse 10043976 Obq33_m obesity QTL 33 (mouse) Not determined 11 98500469 121973369 Mouse 1301057 Nidd4_m non-insulin-dependent diabetes mellitus 4 (mouse) Not determined 11 96810136 121973369 Mouse 1301958 Alcp18_m alcohol preference locus 18 (mouse) Not determined 11 95403965 121973369 Mouse 15014785 Mvlq1_m macrovesicular liver lesion QTL 1 (mouse) 11 86608320 120608320 Mouse 15039374 Adip29_m adiposity 29 (mouse) 11 86608320 120608320 Mouse 1300962 Cd8mts4_m CD8 memory T cell subset 4 (mouse) Not determined 11 96137674 121973369 Mouse 1301095 El6_m epilepsy 6 (mouse) Not determined 11 93229183 121973369 Mouse 27226731 Tibmd4_m tibia midshaft diameter 4, 10 week (mouse) 11 94190826 118890826 Mouse 27226730 Tibmd1_m tibia midshaft diameter 1, 5 week (mouse) 11 62590826 109390826 Mouse 15039376 Bw42_m body weight QTL 42 (mouse) 11 86608320 120608320 Mouse 14700693 Ppiq12_m prepulse inhibition QTL 12 (mouse) 11 101504820 114472363 Mouse 1558753 Ath19_m atherosclerosis 19 (mouse) Not determined 11 91604608 121973369 Mouse 14700694 Ppiq13_m prepulse inhibition QTL 13 (mouse) 11 101504820 114472363 Mouse 14700695 Ppiq14_m prepulse inhibition QTL 14 (mouse) 11 101504820 114472363 Mouse 10044001 Alcw8_m alcohol withdrawal 8 (mouse) Not determined 11 99254187 121973369 Mouse 14700696 Ppiq15_m prepulse inhibition QTL 15 (mouse) 11 101504820 114472363 Mouse 11553867 Stmm5_m skin tumor modifier of MSM 5 (mouse) 11 100058103 121973369 Mouse 10044007 Hbnr14_m Heligmosomoides bakeri nematode resistance 14 (mouse) Not determined 11 87502600 121502698 Mouse
AI553404
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 106,502,299 - 106,502,445 UniSTS GRCm38 MGSCv37 11 106,363,613 - 106,363,759 UniSTS GRCm37 Celera 11 118,233,686 - 118,233,832 UniSTS Cytogenetic Map 11 D UniSTS cM Map 11 61.0 UniSTS Whitehead/MRC_RH 11 1436.06 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000042780 ⟹ ENSMUSP00000041985
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 106,392,973 - 106,503,756 (-) Ensembl GRCm38.p6 Ensembl 11 106,502,147 - 106,612,930 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000103070 ⟹ ENSMUSP00000099359
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 106,434,884 - 106,469,939 (-) Ensembl GRCm38.p6 Ensembl 11 106,544,058 - 106,579,113 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000128933 ⟹ ENSMUSP00000120781
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 106,458,924 - 106,504,249 (-) Ensembl GRCm38.p6 Ensembl 11 106,568,098 - 106,613,423 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000153870 ⟹ ENSMUSP00000119568
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 106,459,309 - 106,471,426 (-) Ensembl GRCm38.p6 Ensembl 11 106,568,483 - 106,580,600 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000207249 ⟹ ENSMUSP00000146465
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 106,393,219 - 106,457,936 (-) Ensembl GRCm38.p6 Ensembl 11 106,502,393 - 106,567,110 (-) Ensembl
RefSeq Acc Id:
NM_198292 ⟹ NP_938034
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,392,965 - 106,503,756 (-) NCBI GRCm38 11 106,502,139 - 106,612,930 (-) NCBI MGSCv37 11 106,363,453 - 106,474,244 (-) RGD Celera 11 118,233,526 - 118,344,699 (-) RGD cM Map 11 ENTREZGENE
Sequence:
CTGGAGCAGGAGCCGCGGCGGCCGCCAAGTACGGGCGCCGGTGTAGTAGGATGAGGCAGCCAGCGGATCCGGGAGCCTGAGCCTTTGCAAAGCCGGCAATGACAAGTCTGAATGGTCGCCATGCTGAG
hide sequence
RefSeq Acc Id:
XM_006533143 ⟹ XP_006533206
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,469,992 (-) NCBI GRCm38 11 106,502,336 - 106,579,171 (-) NCBI
Sequence:
TTCTAGAAAGTTCCTTGAGGACAATGGACAAGAGTCCCCTTATGTCACAGCTCAGGAAGGTGGAGTAAGTGCAGGACCTGCCCACTCAGGGTCTCAGCCCTCCTCAAAGCACCTGCCTCATGGCTGCG
hide sequence
RefSeq Acc Id:
XM_006533144 ⟹ XP_006533207
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,471,339 (-) NCBI GRCm38 11 106,502,336 - 106,580,513 (-) NCBI
Sequence:
GGGATTATATGGACTAAGGCAGCTTGGAGAATTAAGGAAGGTAGCACTGCAGATAACCATTTGGCAAATTCCATGATGGACAAGAGTGAAGCCTGAGCCTTTGCAAAGCCGGCAATGACAAGTCTGAA
hide sequence
RefSeq Acc Id:
XM_006533145 ⟹ XP_006533208
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,504,259 (-) NCBI GRCm38 11 106,502,336 - 106,613,433 (-) NCBI
Sequence:
TCCAGTTTCTGGAACTAGCAGGGATTGATAAAGTCCGACGTCCTCCTAAGACCTCTGTTCCTAA
hide sequence
RefSeq Acc Id:
XM_006533146 ⟹ XP_006533209
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,503,904 (-) NCBI GRCm38 11 106,502,336 - 106,613,018 (-) NCBI
Sequence:
GGTGCGCGGCTGGCCCCGCCCCCTCCGCCCTGTGGTTGGGCGGTGGGGGCCGCGGCCGCGGGGCGGGTCCGCCGGCGGGGCGGGACGGCCGGTGCCCGGGGGCGGGCGGGCAGCAGCACGGCGGCCCC
hide sequence
RefSeq Acc Id:
XM_006533147 ⟹ XP_006533210
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,471,341 (-) NCBI GRCm38 11 106,502,336 - 106,580,515 (-) NCBI
Sequence:
CTGGGATTATATGGACTAAGGCAGCTTGGAGAATTAAGGAAGGTAGCACTGCAGATAACCATTT
hide sequence
RefSeq Acc Id:
XM_006533148 ⟹ XP_006533211
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,503,862 (-) NCBI GRCm38 11 106,502,336 - 106,613,002 (-) NCBI
Sequence:
GTGGGGGCCGCGGCCGCGGGGCGGGTCCGCCGGCGGGGCGGGACGGCCGGTGCCCGGGGGCGGGCGGGCAGCAGCACGGCGGCCCCAGCCAGAGCCGGAGCTGGAGCTGGAGCAGGAGCCGCGGCGGC
hide sequence
RefSeq Acc Id:
XM_036156621 ⟹ XP_036012514
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,503,844 (-) NCBI
Sequence:
GGGCGGGTCCGCCGGCGGGGCGGGACGGCCGGTGCCCGGGGGCGGGCGGGCAGCAGCACGGCGGCCCCAGCCAGAGCCGGAGCTGGAGCTGGAGCAGGAGCCGCGGCGGCCGCCAAGTACGGGCGCCG
hide sequence
RefSeq Acc Id:
XM_036156622 ⟹ XP_036012515
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,503,904 (-) NCBI
Sequence:
GGTGCGCGGCTGGCCCCGCCCCCTCCGCCCTGTGGTTGGGCGGTGGGGGCCGCGGCCGCGGGGC
hide sequence
RefSeq Acc Id:
XM_036156623 ⟹ XP_036012516
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 106,393,162 - 106,504,259 (-) NCBI
Sequence:
TCCAGTTTCTGGAACTAGCAGGGATTGATAAAGTCCGACGTCCTCCTAAGACCTCTGTTCCTAAGAATCTGCCTAGCCAGACAGTTTCCCTCACGGCTTGGAGGCACTTGTTGCTAAATTGCAGGAAG
hide sequence
RefSeq Acc Id:
NP_938034 ⟸ NM_198292
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533208 ⟸ XM_006533145
- Peptide Label:
isoform X1
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533211 ⟸ XM_006533148
- Peptide Label:
isoform X2
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533209 ⟸ XM_006533146
- Peptide Label:
isoform X1
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533210 ⟸ XM_006533147
- Peptide Label:
isoform X1
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533207 ⟸ XM_006533144
- Peptide Label:
isoform X1
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
RefSeq Acc Id:
XP_006533206 ⟸ XM_006533143
- Peptide Label:
isoform X1
- UniProtKB:
B1ATR1 (UniProtKB/Swiss-Prot), Q6ZPJ0 (UniProtKB/Swiss-Prot)
- Sequence:
MTSLNGRHAEKTIDMPKPSAPKVHVQRSVSRDTIAIHFSASGEEEEEEEEEFRGYLEEGLDDQSIVTGLEAKEDLYLESQGGHDPAGPVSTAPADGLSVSESPAILPVSENTVKLLESPAPALQVLSP
hide sequence
Ensembl Acc Id:
ENSMUSP00000041985 ⟸ ENSMUST00000042780
Ensembl Acc Id:
ENSMUSP00000146465 ⟸ ENSMUST00000207249
Ensembl Acc Id:
ENSMUSP00000120781 ⟸ ENSMUST00000128933
Ensembl Acc Id:
ENSMUSP00000119568 ⟸ ENSMUST00000153870
Ensembl Acc Id:
ENSMUSP00000099359 ⟸ ENSMUST00000103070
RefSeq Acc Id:
XP_036012516 ⟸ XM_036156623
- Peptide Label:
isoform X2
RefSeq Acc Id:
XP_036012515 ⟸ XM_036156622
- Peptide Label:
isoform X2
RefSeq Acc Id:
XP_036012514 ⟸ XM_036156621
- Peptide Label:
isoform X1
- UniProtKB:
Q6ZPJ0 (UniProtKB/Swiss-Prot), B1ATR1 (UniProtKB/Swiss-Prot)
RGD ID: 6822302 Promoter ID: MM_KWN:10252 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Liver, Spleen Transcripts: UC007LZB.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 106,430,614 - 106,431,114 (-) MPROMDB
RGD ID: 6822300 Promoter ID: MM_KWN:10254 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day3, Liver Transcripts: OTTMUST00000007198 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 106,441,876 - 106,442,376 (-) MPROMDB
RGD ID: 6822299 Promoter ID: MM_KWN:10255 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, 3T3L1_Day6, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Kidney, Liver, Lung, MEF_B6 Transcripts: NM_198292, OTTMUST00000007197 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 106,474,191 - 106,474,757 (-) MPROMDB
RGD ID: 8677100 Promoter ID: EPDNEW_M16578 Type: initiation region Name: Tex2_2 Description: Mus musculus testis expressed gene 2 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M16579 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 11 106,579,120 - 106,579,180 EPDNEW
RGD ID: 8677096 Promoter ID: EPDNEW_M16579 Type: initiation region Name: Tex2_1 Description: Mus musculus testis expressed gene 2 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M16578 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 11 106,612,967 - 106,613,027 EPDNEW
