Advanced Search (OLGA)

Gene: MT4 (metallothionein 4) Canis lupus familiaris

Subscribe to Updates

Analyze

Symbol:

MT4

Name:

metallothionein 4

RGD ID:

12427756

Description:

ENCODES a protein that exhibits metal ion binding (inferred); INVOLVED IN intracellular monoatomic cation homeostasis (inferred); ASSOCIATED WITH Bardet-Biedl syndrome (ortholog); Chromosome 16q12 Duplication Syndrome (ortholog); developmental and epileptic encephalopathy (ortholog)

Type:

protein-coding

RefSeq Status:

PROVISIONAL

Previously known as:

metallothionein IV; metallothionein-4; MT-4; MT-IV

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MT4 (metallothionein 4)	HGNC	EggNOG, Ensembl, Inparanoid, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):	Mt4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Rattus norvegicus (Norway rat):	Mt4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Mt4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	2	59,640,784 - 59,643,370 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	2	59,640,784 - 59,643,370 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	2	56,274,439 - 56,277,025 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	2	60,185,523 - 60,194,231 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	2	60,185,523 - 60,188,111 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	2	57,016,133 - 57,018,721 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	2	58,025,028 - 58,027,614 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	2	58,917,965 - 58,920,560 (-)	NCBI		UU_Cfam_GSD_1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MT4	Dog	Bardet-Biedl syndrome		ISO	RGD:1343695	8554872	ClinVar Annotator: match by term: Bardet-Biedl syndrome	ClinVar	PMID:11285252\|PMID:20177705\|PMID:24608809\|PMID:26518167\|PMID:28492532\|PMID:28747448\|PMID:30866059
MT4	Dog	Chromosome 16q12 Duplication Syndrome		ISO	RGD:1343695	8554872	ClinVar Annotator: match by term: Chromosome 16q12 duplication syndrome	ClinVar	PMID:25741868
MT4	Dog	developmental and epileptic encephalopathy		ISO	RGD:1343695	8554872	ClinVar Annotator: match by term: Developmental and epileptic encephalopathy	ClinVar	PMID:11285252\|PMID:20177705\|PMID:24608809\|PMID:26518167\|PMID:28492532\|PMID:28747448\|PMID:30866059
MT4	Dog	early infantile epileptic encephalopathy		ISO	RGD:1343695	8554872	ClinVar Annotator: match by term: Early infantile epileptic encephalopathy	ClinVar	PMID:11285252\|PMID:20177705\|PMID:24608809\|PMID:26518167\|PMID:28492532\|PMID:28747448\|PMID:30866059

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MT4	Dog	kidney disease		ISO	RGD:1343695	9068941	CTD Direct Evidence: marker/mechanism	CTD	PMID:19921116
MT4	Dog	Lead Poisoning		ISO	RGD:1343695	9068941	CTD Direct Evidence: marker/mechanism	CTD	PMID:19921116

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MT4	Dog	cellular response to cadmium ion	involved_in	IBA	PANTHER:PTN000591618\|UniProtKB:P04731\|UniProtKB:P04732\|UniProtKB:P04733\|UniProtKB:P13640\|UniProtKB:P80294\|UniProtKB:P80297	150520179		GO_Central	GO_REF:0000033
MT4	Dog	cellular response to copper ion	involved_in	IBA	PANTHER:PTN000591618\|UniProtKB:P13640	150520179		GO_Central	GO_REF:0000033
MT4	Dog	cellular response to zinc ion	involved_in	IBA	MGI:97171\|PANTHER:PTN000591618\|UniProtKB:P02795\|UniProtKB:P04731\|UniProtKB:P04732\|UniProtKB:P07438\|UniProtKB:P13640\|UniProtKB:P80294\|UniProtKB:P80297\|UniProtKB:Q93083	150520179		GO_Central	GO_REF:0000033
MT4	Dog	detoxification of copper ion	involved_in	IBA	MGI:97171\|MGI:97172\|PANTHER:PTN000591618	150520179		GO_Central	GO_REF:0000033
MT4	Dog	intracellular monoatomic cation homeostasis	acts_upstream_of_or_within	IEA	UniProtKB:P47945\|ensembl:ENSMUSP00000034207	150520179		Ensembl	GO_REF:0000107
MT4	Dog	intracellular zinc ion homeostasis	involved_in	IBA	MGI:97171\|MGI:97172\|MGI:97173\|PANTHER:PTN000591618	150520179		GO_Central	GO_REF:0000033

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MT4	Dog	cytoplasm	is_active_in	IBA	MGI:97171\|MGI:97173\|PANTHER:PTN000591618\|RGD:621252\|UniProtKB:P04732\|UniProtKB:P04733\|UniProtKB:P13640\|UniProtKB:P25713\|UniProtKB:P80297	150520179		GO_Central	GO_REF:0000033
MT4	Dog	nucleus	is_active_in	IBA	PANTHER:PTN000591618\|UniProtKB:P04732\|UniProtKB:P04733\|UniProtKB:P13640\|UniProtKB:P80297	150520179		GO_Central	GO_REF:0000033

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MT4	Dog	metal ion binding	enables	IBA	MGI:97171\|MGI:97173\|MGI:99692\|PANTHER:PTN000591618\|RGD:621252\|UniProtKB:P13640\|UniProtKB:P25713	150520179		GO_Central	GO_REF:0000033
MT4	Dog	metal ion binding	enables	IEA	InterPro:IPR000006\|InterPro:IPR017854	150520179		InterPro	GO_REF:0000002
MT4	Dog	metal ion binding	enables	IEA	UniProtKB:P47945\|ensembl:ENSMUSP00000034207	150520179		Ensembl	GO_REF:0000107
MT4	Dog	metal ion binding	enables	IEA	UniProtKB-KW:KW-0479\|UniProtKB-KW:KW-0480	150520179		UniProt	GO_REF:0000043

PMID:22301074	PMID:30032202

MT4
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	2	59,640,784 - 59,643,370 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	2	59,640,784 - 59,643,370 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	2	56,274,439 - 56,277,025 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	2	60,185,523 - 60,194,231 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	2	60,185,523 - 60,188,111 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	2	57,016,133 - 57,018,721 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	2	58,025,028 - 58,027,614 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	2	58,917,965 - 58,920,560 (-)	NCBI		UU_Cfam_GSD_1.0

MT4
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	16	56,565,073 - 56,568,957 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	16	56,565,073 - 56,568,957 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	16	56,598,985 - 56,602,869 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	16	55,156,462 - 55,160,370 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	16	55,156,541 - 55,160,345	NCBI
Celera	16	41,096,796 - 41,100,689 (+)	NCBI		Celera
Cytogenetic Map	16	q13	NCBI
HuRef	16	42,469,024 - 42,472,836 (+)	NCBI		HuRef
CHM1_1	16	58,005,846 - 58,009,677 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	16	62,359,992 - 62,363,895 (+)	NCBI		T2T-CHM13v2.0

Mt4
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	94,863,832 - 94,865,659 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	8	94,863,825 - 94,865,659 (+)	Ensembl		GRCm39 Ensembl
GRCm38	8	94,137,204 - 94,139,031 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	94,137,197 - 94,139,031 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	8	96,661,104 - 96,662,931 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	8	97,026,371 - 97,027,996 (+)	NCBI		MGSCv36	mm8
Celera	8	98,468,827 - 98,470,654 (+)	NCBI		Celera
Cytogenetic Map	8	C5	NCBI
cM Map	8	46.26	NCBI

Mt4
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	19	10,869,735 - 10,871,831 (-)	NCBI		GRCr8
mRatBN7.2	19	10,863,813 - 10,865,909 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	19	10,863,813 - 10,865,909 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	19	10,831,713 - 10,833,804 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	19	11,598,567 - 11,600,658 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	19	10,885,565 - 10,887,656 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	19	11,339,767 - 11,341,863 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	19	11,339,767 - 11,341,863 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	19	11,315,073 - 11,317,169 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	19	11,300,057 - 11,302,153 (-)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	19	10,749,778 - 10,751,874 (-)	NCBI		Celera
Cytogenetic Map	19	p12	NCBI

MT4
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	18	66,042,237 - 66,051,433 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	16	71,961,794 - 71,970,293 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	16	36,848,200 - 36,855,987 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	16	55,984,536 - 55,988,258 (+)	NCBI	panpan1.1	PanPan1.1	panPan2

Mt4
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024409349	50,743,969 - 50,785,927 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936475	8,809,813 - 8,845,137 (+)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936475	8,842,863 - 8,845,105 (+)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

MT4
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	6	18,610,820 - 18,614,782 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	6	18,611,245 - 18,613,956 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1

Variants in MT4
27 total Variants

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

adipose tissue	alimentary part of gastrointestinal system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	reproductive system	respiratory system
4	1	14	6	3	2	1	2	6	6	3	7	8	1


RefSeq Transcripts	NM_001003150	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_038657715	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000002	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AB028041	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000031	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000045	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000373	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000002	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSCAFT00000014504 ⟹ ENSCAFP00000013416

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1 Ensembl	2	59,640,784 - 59,643,370 (-)	Ensembl

Ensembl Acc Id:

ENSCAFT00845006961 ⟹ ENSCAFP00845005550

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
ROS_Cfam_1.0 Ensembl	2	60,185,523 - 60,188,111 (-)	Ensembl

RefSeq Acc Id:

NM_001003150 ⟹ NP_001003150

RefSeq Status:

PROVISIONAL

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	2	59,640,784 - 59,643,370 (-)	NCBI
Dog10K_Boxer_Tasha	2	56,274,439 - 56,277,025 (-)	NCBI
ROS_Cfam_1.0	2	60,185,523 - 60,188,111 (-)	NCBI
UMICH_Zoey_3.1	2	57,016,133 - 57,018,721 (-)	NCBI
UNSW_CanFamBas_1.0	2	58,025,028 - 58,027,614 (-)	NCBI
UU_Cfam_GSD_1.0	2	58,917,965 - 58,920,560 (-)	NCBI

Sequence:

show sequence

CCAGCTGTGACAGCATTGGAGCTTCTTGGACACCTGGACATGGACCCCGGGGAATGCACCTGCATGTCTGGAGGAATCTGTATCTGTGGAGACAATTGCAAATGTACAACCTGCAACTGTAAAACATG
TCGAAAAAGCTGCTGTCCTTGCTGCCCCCCCGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGAGGCTCGGACAAGTGCAGCTGCTGTGCCTGAACCGCATCCGTGGTGCTGGGGCTGGCGG
GGGCGGGGGTTGTGGATGCCACAGCCCCGGAAATGTCTGTACAGTGCATTAGTTGAGAAACTGAAATTATTGTACCATAGGTTATGCTTTTTATATATTTGCTCAGAGGTGGTGGTGGTGACACTCAT
GTAAAGTGCCTGAAAAATAAAGTCTTCACTTGTGGTAAAAAAAAAAAAAAAAAAAAAAAAA

hide sequence

RefSeq Acc Id:

XM_038657715 ⟹ XP_038513643

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
ROS_Cfam_1.0	2	60,185,524 - 60,194,231 (-)	NCBI


Protein RefSeqs	NP_001003150	(Get FASTA)	NCBI Sequence Viewer
	XP_038513643	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	BAA87326	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSCAFP00000013416.1
	ENSCAFP00030006943.1
	ENSCAFP00040022369.1
	ENSCAFP00845005550
	ENSCAFP00845005550.1
GenBank Protein	Q9TUI5	(Get FASTA)	NCBI Sequence Viewer

RefSeq Acc Id:	NP_001003150 ⟸ NM_001003150
- UniProtKB:	Q9TUI5 (UniProtKB/Swiss-Prot)
- Sequence:	show sequence MDPGECTCMSGGICICGDNCKCTTCNCKTCRKSCCPCCPPGCAKCAQGCICKGGSDKCSCCA hide sequence

Ensembl Acc Id:

ENSCAFP00000013416 ⟸ ENSCAFT00000014504

RefSeq Acc Id:	XP_038513643 ⟸ XM_038657715
- Peptide Label:	isoform X1
- UniProtKB:	Q9TUI5 (UniProtKB/Swiss-Prot)

Ensembl Acc Id:

ENSCAFP00845005550 ⟸ ENSCAFT00845006961

Database	Acc Id	Source(s)
Ensembl Genes	ENSCAFG00000009118	Ensembl, UniProtKB/Swiss-Prot
	ENSCAFG00030004291	UniProtKB/Swiss-Prot
	ENSCAFG00040013937	UniProtKB/Swiss-Prot
	ENSCAFG00845003871	Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Transcript	ENSCAFT00000014504.2	UniProtKB/Swiss-Prot
	ENSCAFT00030007915.1	UniProtKB/Swiss-Prot
	ENSCAFT00040025722.1	UniProtKB/Swiss-Prot
	ENSCAFT00845006961	ENTREZGENE
	ENSCAFT00845006961.1	UniProtKB/Swiss-Prot
Gene3D-CATH	4.10.10.10	UniProtKB/Swiss-Prot
InterPro	Metalthion_dom_sf	UniProtKB/Swiss-Prot
	Metalthion_dom_sf_vert	UniProtKB/Swiss-Prot
	Metalthion_vert	UniProtKB/Swiss-Prot
	Metalthion_vert_metal_BS	UniProtKB/Swiss-Prot
KEGG Report	cfa:403769	UniProtKB/Swiss-Prot
NCBI Gene	MT4	ENTREZGENE
PANTHER	METALLOTHIONEIN-4	UniProtKB/Swiss-Prot
	PTHR23299	UniProtKB/Swiss-Prot
Pfam	Metallothio	UniProtKB/Swiss-Prot
PRINTS	MTVERTEBRATE	UniProtKB/Swiss-Prot
PROSITE	METALLOTHIONEIN_VRT	UniProtKB/Swiss-Prot
Superfamily-SCOP	SSF57868	UniProtKB/Swiss-Prot
UniProt	MT4_CANLF	UniProtKB/Swiss-Prot, ENTREZGENE
VGNC ID	VGNC:52145	ENTREZGENE

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD