D4Arb25 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D4Arb25

Symbol: D4Arb25
Previously known as: oxsts7881; R0266-B09; 
RGD ID: 42156
Expected Size: 361 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8435,396,600 - 35,396,961 (+)Marker Load Pipeline
mRatBN7.2434,430,119 - 34,430,484 (+)MAPPERmRatBN7.2
Rnor_6.0431,825,200 - 31,825,560NCBIRnor6.0
Rnor_5.0431,693,152 - 31,693,512UniSTSRnor5.0
RGSC_v3.4431,074,596 - 31,074,957RGDRGSC3.4
RGSC_v3.4431,074,597 - 31,074,957UniSTSRGSC3.4
Celera429,953,170 - 29,953,530UniSTS
RGSC_v3.1431,146,380 - 31,146,741RGD
FHH x ACI Map421.06RGD
FHH x ACI Map421.06UniSTS
Cytogenetic Map4 RGD
Is Marker For: Strains:   ACI/N ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs:   Vie1   Rf60   Bw143   Bw144   Vie5   Rf62  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GTTGGAGATAATTGACCACC
Reverse Primer AGGTTTCCATAAGGACTCCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
7657264LOC102554854uncharacterized LOC10255485443538135835405497Rat

Nucleotide Sequences
GenBank Nucleotide AC105600 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U06690 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)41308014658080146Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41564430960644309Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)43511329080113290Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41103870656038706Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)427730518170099664Rat
8655949Rf62Renal function QTL 6222blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)43539660045429897Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)4135396961Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41103870656038706Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)42228845340471598Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)426234499134199155Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4589457557613242Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41103870656038706Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41170660492690519Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41890069763900697Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4145429897Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)4135396961Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)427862204126119996Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41103870656038706Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)4135396961Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45889999148002343Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42228845363245191Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)41890069763900697Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41103870656038706Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)43044896182336920Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4140471598Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4588999950889999Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)4135396961Rat
7387227Uae40Urinary albumin excretion QTL 402.90.0052urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)41891315163913151Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42786220462997402Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42192515166925151Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)4163900697Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41103870656038706Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)433538597116185060Rat
11530004Niddm71Non-insulin dependent diabetes mellitus QTL 710.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43353881653719714Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)412212457182430611Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42228845345429897Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)41075870140490708Rat


Additional Information

RGD Curation Notes
Note Type Note Reference