D20Arb10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D20Arb10

Symbol: D20Arb10
Previously known as: oxsts7796; R0270-D06; D20Arb249; 
RGD ID: 42096
Expected Size: 270 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr82052,896,240 - 52,896,510 (+)Marker Load Pipeline
mRatBN7.22051,313,962 - 51,314,232 (+)MAPPERmRatBN7.2
Rnor_6.02052,966,884 - 52,967,153NCBIRnor6.0
Rnor_5.02054,571,986 - 54,572,255UniSTSRnor5.0
RGSC_v3.42052,214,729 - 52,214,999RGDRGSC3.4
RGSC_v3.42052,214,730 - 52,214,999UniSTSRGSC3.4
Celera2048,774,140 - 48,774,409UniSTS
RGSC_v3.12052,243,426 - 52,243,696RGD
SHRSP x BN Map2048.2299UniSTS
SHRSP x BN Map2048.2299RGD
FHH x ACI Map2034.0098RGD
Cytogenetic Map20 RGD
Is Marker For: Strains:   ACI/N ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCAAGACACTTAGTGCTATG
Reverse Primer GCATACCTTGGAAACTGTTC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474025 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000250 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202668936256021148Rat
1598858Cm61Cardiac mass QTL 613.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)20821635953216359Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202679235356021148Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202668936256021148Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)202074558556021148Rat
1598869Memor6Memory QTL 63.1exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)202668936256021148Rat
1598870Bp289Blood pressure QTL 2892.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)20821635953216359Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202668936256021148Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide U12241
  U12242