D18Arb6 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D18Arb6

Symbol:

D18Arb6

Previously known as:

oxsts7741; R0270-C08;

RGD ID:

42052

Expected Size:

197 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	18	60,377,584 - 60,377,792 (+)	MAPPER	mRatBN7.2
Rnor_6.0	18	62,570,259 - 62,570,466	NCBI	Rnor6.0
Rnor_5.0	18	61,757,020 - 61,757,227	UniSTS	Rnor5.0
Celera	18	58,484,894 - 58,485,101	UniSTS
SHRSP x BN Map	18	33.2299	RGD
SHRSP x BN Map	18	33.2299	UniSTS
FHH x ACI Map	18	43.03	RGD
Cytogenetic Map	18		RGD

Is Marker For:

Strains: ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs: Iddm35

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines
5.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	GTCCAATCTCACCGTCAATACC
Reverse Primer	CAGAAACACATGTAACTCCAGC

Strain Variation

Strain, Expected Size(s)

ACI/N	239
AVN/Orl	239
BBDP/Rhw	213
BBDR/Rhw	213
BC/CpbU	213
BDIX/Han	239
BDVII/Cub	239
BN-Lx/Cub	207
BN/SsNHsd	207
BP/Cub	239
BUF/Pit	213
COP/OlaHsd	239

DA/PitN	239
DON/Melb	239
F344/Pit	239
FHH/Eur	243
GH/Omr	213
GK/KyoSwe	197
IS/Kyo	215
LE/Mol	239
LEW/Pit	197
LH/Mav	213
LN/Mav	213
LOU/CHan	213

M520/N	239
MHS/Gib	201
MNR/N	213
MNRA/N	213
MNS/Gib	213
MR/Pit	213
NEDH/K	197
NP9	213
ODU/N	239
OKA/Wsl	211
OM/Ztm	213
P5C	213

SD/Rij	239
SHR/OlaHsd	207
SHRSP/Riv	211
SR/Jr	213
SS/Jr	213
WAG/RijKyo	213
WF/Pit	213
WIST/Nhg	215
WKY/OlaHsd	197
WN/N	213
WTC/Kyo	239

Region

Nucleotide Sequences


GenBank Nucleotide	X06656	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100303122	UniSTS
NCBI Nucleotide	M19317

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D18Arb6