D12Arb6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D12Arb6

Symbol: D12Arb6
Previously known as: oxsts7670; R0269-B01; 
RGD ID: 41962
Expected Size: 290 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21235,682,559 - 35,682,913 (+)MAPPERmRatBN7.2
mRatBN7.21235,682,559 - 35,682,913 (-)MAPPERmRatBN7.2
Rnor_6.01241,213,448 - 41,213,801NCBIRnor6.0
Rnor_6.01241,291,378 - 41,291,738NCBIRnor6.0
Rnor_5.01243,150,549 - 43,150,909UniSTSRnor5.0
RGSC_v3.41236,818,781 - 36,819,134UniSTSRGSC3.4
RGSC_v3.41236,894,447 - 36,894,750UniSTSRGSC3.4
RGSC_v3.41236,894,446 - 36,894,750RGDRGSC3.4
RGSC_v3.41236,818,780 - 36,819,134RGDRGSC3.4
Celera1237,346,026 - 37,346,376UniSTS
Celera1237,422,909 - 37,423,212UniSTS
RGSC_v3.11236,757,835 - 36,758,138RGD
RH 3.4 Map12618.9RGD
RH 3.4 Map12618.9UniSTS
RH 2.0 Map12466.8RGD
SHRSP x BN Map1244.35RGD
Cytogenetic Map12 RGD
Is Marker For: Strains:   SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr
QTLs:   Cia12   Cia25   Bp269   Bp268  
Genes:   Oas3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Identification of four new quantitative trait loci regulating arthritis severity and one new quantitative trait locus regulating autoantibody production in rats with collagen-induced arthritis. Griffiths MM, etal., Arthritis Rheum 2000 Jun;43(6):1278-89
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
5. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
6. UniSTS Pipeline RGD automated pipelines
7. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
8. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
9. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TGACAGGACAGAAAGCCCATCC
Reverse Primer ATCAAAGATGGCAGTTGTGGGC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473973 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302789 UniSTS
  100302793 UniSTS
  326429 UniSTS
  408115 UniSTS
  494202 UniSTS