D14Rat94 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D14Rat94

Symbol: D14Rat94
Previously known as: oxsts9601; R0112-C01; 
RGD ID: 41138
Expected Size: 271 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81487,581,824 - 87,582,095 (+)Marker Load Pipeline
mRatBN7.21483,368,062 - 83,368,335 (+)MAPPERmRatBN7.2
Rnor_6.01488,870,724 - 88,870,994NCBIRnor6.0
Rnor_5.01488,669,660 - 88,669,930UniSTSRnor5.0
RGSC_v3.41489,192,602 - 89,192,873RGDRGSC3.4
RGSC_v3.41489,192,603 - 89,192,873UniSTSRGSC3.4
Celera1482,410,120 - 82,410,410UniSTS
RGSC_v3.11489,211,748 - 89,212,018RGD
RH 3.4 Map14611.9UniSTS
RH 3.4 Map14611.9RGD
RH 2.0 Map14729.2RGD
SHRSP x BN Map1449.4699RGD
Is Marker For: Strains:   LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav
QTLs:   Bp59   Hcas6  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCAGAGAGGGAGTGACATG
Reverse Primer GAAAAGGTTCTCACCGTTCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1564174Tns3tensin 3148738744187619457Rat
41280378LOC12009665960S ribosomal protein L36-like148758194787586444Rat

Nucleotide Sequences
GenBank Nucleotide JH618198.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631213Bw60Body weight QTL604.51retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)1484164970100078267Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147764007196755654Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1459848686104848686Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1477914838104348525Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)147297021087582095Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1433424686102238540Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1474255551109089856Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147764007196755654Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1462398852107398852Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1477640071100078267Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1460854936105854936Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1474255551109089856Rat
4889951Bss92Bone structure and strength QTL 923.9tibia area (VT:1000281)tibia-fibula cortical bone total cross-sectional area (CMO:0001721)1486271332100078267Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1411334716100078267Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147764007196755654Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1459848686104848686Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147764007196755654Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144261625899224555Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)146592028399224555Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143941117087582095Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 326480 UniSTS
  408173 UniSTS