D6Rat136 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D6Rat136

Symbol:

D6Rat136

Previously known as:

oxsts11200; R0107-A01;

RGD ID:

41006

Expected Size:

232 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	6	52,625,268 - 52,625,500 (+)	Marker Load Pipeline
Rnor_6.0	6	49,218,700 - 49,218,931	NCBI	Rnor6.0
Rnor_5.0	6	57,898,943 - 57,899,174	UniSTS	Rnor5.0
RGSC_v3.4	6	48,155,752 - 48,155,984	RGD	RGSC3.4
RGSC_v3.4	6	48,155,753 - 48,155,984	UniSTS	RGSC3.4
Celera	6	46,101,723 - 46,101,952	UniSTS
RGSC_v3.1	6	48,158,878 - 48,159,110	RGD
SHRSP x BN Map	6	34.1598	RGD
SHRSP x BN Map	6	34.1598	UniSTS
Cytogenetic Map	6	q16	UniSTS

Is Marker For:

Strains: ACI/N ; AVN/Orl ; BBDR/Rhw ; BC/CpbU ; BDIX/Han ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
Genes: Sntg2

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	TATTTAGCATGCAGGGACCC
Reverse Primer	TTCCATAGGGCTAAACTAGGG

Strain Variation

Strain, Expected Size(s)

ACI/N	165
AVN/Orl	165
BBDR/Rhw	172
BC/CpbU	163
BDIX/Han	165
BN-Lx/Cub	234
BN/SsNHsd	234
BP/Cub	165
BUF/Pit	202
COP/OlaHsd	165
DA/PitN	165
DON/Melb	165

F344/Pit	165
FHH/Eur	170
GH/Omr	165
GK/KyoSwe	165
IS/Kyo	230
LE/Mol	172
LEW/Pit	172
LH/Mav	225
LN/Mav	225
LOU/CHan	165
M520/N	165
MHS/Gib	230

MNR/N	165
MNRA/N	165
MNS/Gib	167
MR/Pit	165
NEDH/K	165
NP9	165
ODU/N	165
OKA/Wsl	165
OM/Ztm	172
P5C	165
PVG/Pit	174
SD/Rij	230

SHR/OlaHsd	165
SHRSP/Riv	165
SR/Jr	165
SS/Jr	165
WAG/RijKyo	165
WF/Pit	165
WIST/Nhg	165
WKY/OlaHsd	165
WN/N	172
WTC/Kyo	165

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1311276	Sntg2	syntrophin, gamma 2	6	52529481	52730972	Rat

Nucleotide Sequences


GenBank Nucleotide	FT112998	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9590290	Uminl2	Urine mineral level QTL 2	3.96	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	6	44510974	89510974	Rat
8693632	Alc27	Alcohol consumption QTL 27	2.2	0.791	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	6	40052411	56848866	Rat
634318	Bw118	Body weight QTL 118	3.55		abdominal fat pad mass (VT:1000711)	abdominal fat pad weight (CMO:0000088)	6	39028659	63457441	Rat
634307	Bp141	Blood pressure QTL 141	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	6	40957564	85957564	Rat
10401812	Kidm54	Kidney mass QTL 54			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	6	20097635	65097635	Rat
1331743	Uae28	Urinary albumin excretion QTL 28	4.5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	6	45153786	90153786	Rat
8552910	Pigfal5	Plasma insulin-like growth factor 1 level QTL 5	4.3		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	6	22653889	67653889	Rat
10401800	Kidm49	Kidney mass QTL 49			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	6	20097635	65097635	Rat
1331779	Rf38	Renal function QTL 38	2.876		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	6	31185002	76185002	Rat
737827	Hcar11	Hepatocarcinoma resistance QTL 11	4.4		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	6	46050607	116278722	Rat
724513	Uae14	Urinary albumin excretion QTL 14	6.5		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	6	46047353	91047353	Rat
2293839	Kiddil2	Kidney dilation QTL 2	4.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	6	26618314	86868070	Rat
1576309	Emca7	Estrogen-induced mammary cancer QTL 7	4		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	6	20859430	113082285	Rat
9590140	Scort4	Serum corticosterone level QTL 4	14.49	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	6	44510974	89510974	Rat
2301964	Bp323	Blood pressure QTL 323	4.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	6	1	86868070	Rat
9590306	Scort18	Serum corticosterone level QTL 18	2.88	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	6	44510974	89510974	Rat
1578665	Bss16	Bone structure and strength QTL 16	4.4		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	6	33328841	78328841	Rat
2293841	Kiddil4	Kidney dilation QTL 4	4.4		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	6	26618314	86868070	Rat
1641898	Colcr4	Colorectal carcinoma resistance QTL4	3.71	0.0007	intestine integrity trait (VT:0010554)	well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)	6	30937632	75937632	Rat
1578668	Bmd14	Bone mineral density QTL 14	3.8		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	6	33328841	78328841	Rat
6893340	Cm77	Cardiac mass QTL 77	0.26	0.57	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	6	39028659	86867923	Rat
70199	Coreg1	Compensatory renal growth QTL 1	11.8		kidney mass (VT:0002707)	compensatory renal growth score (CMO:0001894)	6	14599473	63457687	Rat
2301972	Bp325	Blood pressure QTL 325	4.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	6	16089372	61967788	Rat
1300143	Rf14	Renal function QTL 14	2.92		renal blood flow trait (VT:2000006)	absolute change in renal blood flow rate (CMO:0001168)	6	40163183	85163183	Rat
1354664	Slep2	Serum leptin concentration QTL 2	4.49		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	6	22288257	67288257	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	298936	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D6Rat136