D18Rat53 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D18Rat53

Symbol: D18Rat53
Previously known as: oxsts6467; R0059-A06; 
RGD ID: 37608
Expected Size: 251 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81842,689,940 - 42,690,191 (+)Marker Load Pipeline
mRatBN7.21840,503,281 - 40,503,530 (+)MAPPERmRatBN7.2
Rnor_6.01841,781,369 - 41,781,619NCBIRnor6.0
Rnor_5.01841,422,581 - 41,422,831UniSTSRnor5.0
RGSC_v3.41842,005,988 - 42,006,239RGDRGSC3.4
RGSC_v3.41842,005,989 - 42,006,239UniSTSRGSC3.4
Celera1838,751,068 - 38,751,318UniSTS
RGSC_v3.11842,043,529 - 42,043,780RGD
SHRSP x BN Map1817.1699RGD
SHRSP x BN Map1817.1699UniSTS
FHH x ACI Map1821.56RGD
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs:   Glom21  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCCTCAGTCACAGAGGAAG
Reverse Primer TGGAATCATTTATGCTGGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11366002LOC108348790uncharacterized LOC108348790184265262642786759Rat

Nucleotide Sequences
GenBank Nucleotide CH473971 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000248 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182507112683910656Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)182201556261600538Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182349405785487725Rat
1331742Bp228Blood pressure QTL 2283.88752arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183161050577371277Rat
631834Sach3Saccharin preference QTL 33.90.01consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)183857591983575919Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182682218671822186Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182682218671822186Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182682218671822186Rat
1331727Bp237Blood pressure QTL 2373.053arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183161050563968306Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182682218671822186Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182682218671822186Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182682218671822186Rat
1331774Bp226Blood pressure QTL 2264.41065arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183161050577371277Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)183199089176990891Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183161050585493247Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181206648285493247Rat
12880368Bw187Body weight QTL 1870.045body mass (VT:0001259)body weight (CMO:0000012)183337915878379158Rat
61367Iddm4Insulin dependent diabetes mellitus QTL 42.330.0074blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)184046238385462383Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18448264849482648Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)183199089176990891Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18154490981Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181206648285493247Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181564228086134022Rat
11565454Kidm59Kidney mass QTL 590.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)18706572852065728Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)18430735449307354Rat
12904069Cm123Cardiac mass QTL 1230.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)183337915878379158Rat
1331798Bp224Blood pressure QTL 2243.53873arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183161050577371277Rat
2301409Cm70Cardiac mass QTL 700.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)18706572852065728Rat
12904070Cm124Cardiac mass QTL 1240.01heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)183337915878379158Rat
12904071Am18Aortic mass QTL 180.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)183337915878379158Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182682218671822186Rat
61383Bp47Blood pressure QTL 4717.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)183152278376522783Rat
12904067Cm122Cardiac mass QTL 1220.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)183337915878379158Rat
12904716Am21Aortic mass QTL 210.005aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)18706572852065728Rat
2301417Bp319Blood pressure QTL 3190.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183337915878379158Rat
12904073Kidm71Kidney mass QTL 710.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)183337915878379158Rat
12904714Cm131Cardiac mass QTL 1310.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)18706572852065728Rat
12904715Cm132Cardiac mass QTL 1320.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)18706572852065728Rat
1331776Bp225Blood pressure QTL 2252.829arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)183161050577371277Rat
631518Bw11Body weight QTL 112.8body mass (VT:0001259)body weight (CMO:0000012)183612162681121626Rat
6903345Bp349Blood pressure QTL 3493.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)18391722648917226Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181522610142690662Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)183199089176990891Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18546045542690191Rat
631509Sald2Serum aldosterone level QTL 22.9blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)182641582171415821Rat
6903349Bp351Blood pressure QTL 3513.5arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)18391722648917226Rat
6903351Bp352Blood pressure QTL 3523.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)18391722648917226Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183164450879484311Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)18144930869Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181955353285493247Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181206648257066482Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)183199089176990891Rat
61429Cia17Collagen induced arthritis QTL 174.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)183161050572538878Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303445 UniSTS