D8Rat11 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D8Rat11

Symbol:

D8Rat11

Previously known as:

oxsts7412; R044-D07; R0044-D07;

RGD ID:

36781

Expected Size:

138 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	8	119,799,743 - 119,799,881 (+)	Marker Load Pipeline
mRatBN7.2	8	110,921,334 - 110,921,472 (+)	MAPPER	mRatBN7.2
Rnor_6.0	8	119,211,805 - 119,211,942	NCBI	Rnor6.0
Rnor_5.0	8	118,551,323 - 118,551,460	UniSTS	Rnor5.0
RGSC_v3.4	8	115,337,900 - 115,338,037	UniSTS	RGSC3.4
RGSC_v3.4	8	115,337,809 - 115,338,082	RGD	RGSC3.4
Celera	8	110,203,184 - 110,203,341	UniSTS
RGSC_v3.1	8	115,357,264 - 115,357,537	RGD
RH 2.0 Map	8	913.9	RGD
SHRSP x BN Map	8	71.92	RGD
Cytogenetic Map	8	q32	UniSTS

Is Marker For:

Strains: AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs: Eae16
Genes: Rpl29l4

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines
5.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	ACGCGCAGATCTTTTGAAAG
Reverse Primer	GGTTCTTGGGTGGGTCGTAT

Template	GCAGGTCGACTCTAGAGGATCCCCTTTGTTTTTAAACTATTTTTTTTCTTTTTCGCATGTAGGG GATCCACTCAGAGAGGAAACTGCTTGTGCCCCTCATTACGATGGTCCCAGGTTCTTGGGTGGGT CGTATAAATTATTTTCATATTTATCTATTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG TGTGTGTGTGTGAGCGCGCACGTGTGAATGTCAGGGTAAAGTGTCTCTCGATTGTTCTGTACCT TCTTTCAAAAGATCTGCGCGTGCCAGCCTGGCGTATGTGCACGTTGCACGTGTCTGTGATTAGA GGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTC ACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTG

Strain Variation

Strain, Expected Size(s)

AVN/Orl	140
BBDP/Rhw	136
BBDR/Rhw	136
BC/CpbU	168
BDIX/Han	160
BDVII/Cub	160
BN-Lx/Cub	140
BN/SsNHsd	140
BP/Cub	140
BUF/Pit	140
COP/OlaHsd	140
DA/PitN	140

DON/Melb	168
F344/Pit	168
FHH/Eur	160
GH/Omr	168
GK/KyoSwe	168
IS/Kyo	140
LE/Mol	172
LEW/Pit	140
LH/Mav	140
LN/Mav	160
LOU/CHan	168
M520/N	140

MHS/Gib	140
MNR/N	140
MNRA/N	140
MNS/Gib	140
MR/Pit	140
NEDH/K	140
NP9	140
ODU/N	168
OKA/Wsl	168
OM/Ztm	140
P5C	140
PVG/Pit	168

SD/Rij	168
SHR/OlaHsd	168
SHRSP/Riv	168
SR/Jr	160
SS/Jr	160
WAG/RijKyo	140
WF/Pit	140
WIST/Nhg	140
WKY/OlaHsd	168
WN/N	140
WTC/Kyo	168

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1564138	Rpl29l4	ribosomal protein L29 like 4	8	119794524	119803054	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473954	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000238	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2303171	Bp331	Blood pressure QTL 331	5.57	0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	105462581	132782436	Rat
1549909	Stresp11	Stress response QTL 11	6.83	0.0019	stress-related behavior trait (VT:0010451)	number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)	8	82352698	127352698	Rat
631210	Bw3	Body weight QTL3	5.9		mesenteric fat pad mass (VT:0010427)	mesenteric fat pad weight to body weight ratio (CMO:0000654)	8	61019838	121662124	Rat
9590292	Uminl3	Urine mineral level QTL 3	3.62	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	8	80768445	125768445	Rat
8694446	Bw170	Body weight QTL 170	12.07	0.001	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	8	80768445	125768445	Rat
631650	Stl6	Serum triglyceride level QTL 6	4	0.0019	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	8	70041301	121080908	Rat
1581557	Eae16	Experimental allergic encephalomyelitis QTL 16	3.8		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	8	68690349	119799881	Rat
10450865	Bw175	Body weight QTL 175	4.1		total fat pad mass (VT:0015008)	adipose tissue molecular composition measurement (CMO:0000484)	8	84192326	129192326	Rat
738011	Anxrr9	Anxiety related response QTL 9	6.1		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	8	102413464	132782436	Rat
724539	Cm19	Cardiac mass QTL 19	2.6		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	8	103375781	129871912	Rat
70197	BpQTLcluster8	Blood pressure QTL cluster 8	3.482		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	55428333	127966348	Rat
634332	Pia18	Pristane induced arthritis QTL 18	4		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	8	84192326	132782436	Rat
2300181	Bmd55	Bone mineral density QTL 55	5.7	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	8	85348065	130348065	Rat
1300171	Bp184	Blood pressure QTL 184	3.66		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	8	79394435	132782436	Rat
2313400	Anxrr25	Anxiety related response QTL 25			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	8	98145073	122898010	Rat
8694200	Abfw4	Abdominal fat weight QTL 4	9.07	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	8	80768445	125768445	Rat
8694392	Bw161	Body weight QTL 161	8.06	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	8	80768445	125768445	Rat
61437	Cia6	Collagen induced arthritis QTL 6			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	8	91340911	131690273	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100303208	UniSTS
	367175	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D8Rat11