D15Rat17 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D15Rat17

Symbol: D15Rat17
Previously known as: oxsts6253; R032-A10; R0032-A10; 
RGD ID: 36189
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81544,014,376 - 44,014,576 (+)Marker Load Pipeline
mRatBN7.21539,838,783 - 39,838,985 (+)MAPPERmRatBN7.2
Rnor_6.01549,027,416 - 49,027,615NCBIRnor6.0
Rnor_5.01552,766,530 - 52,766,729UniSTSRnor5.0
RGSC_v3.41545,042,674 - 45,042,874RGDRGSC3.4
RGSC_v3.41545,042,675 - 45,042,874UniSTSRGSC3.4
Celera1539,512,159 - 39,512,358UniSTS
RGSC_v3.11545,058,374 - 45,058,574RGD
RH 2.0 Map15273.1RGD
SHRSP x BN Map1533.5099RGD
FHH x ACI Map1546.36RGD
Cytogenetic Map15p12UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
Genes:   Nuggc  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCTCACACGGGAAAGAAAGA
Reverse Primer GGTATCATGAGTATTCCCCCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562099Nuggcnuclear GTPase, germinal center associated154399744644041716Rat

Nucleotide Sequences
GenBank Nucleotide CH474023 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15231575947315759Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15144836456Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15231575953331089Rat
152025253Hrtrt24Heart rate QTL 243.82heart pumping trait (VT:2000009)153185580392671517Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)154367724488677244Rat
10054130Srcrt8Stress Responsive Cort QTL 82.180.0085blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)152852773273527732Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)154367724488677244Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1525285835104695021Rat
2324620Coatc3Coat color QTL 3coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)152233635152597086Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1525285835104695021Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151915576287086765Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)15278592347785923Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)154046315285463152Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151492659471614418Rat
631550Bw7Body weight QTL 73.6body mass (VT:0001259)body weight (CMO:0000012)152233635167336351Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)154367724488677244Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)154367724488677244Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1525285835104695021Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)154367724488677244Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 290325 UniSTS