D16Rat14 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D16Rat14

Symbol: D16Rat14
Previously known as: oxsts6306; R009-D05; R0009-D05; 
RGD ID: 34959
Expected Size: 134 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81677,313,288 - 77,313,422 (+)Marker Load Pipeline
mRatBN7.21670,610,849 - 70,610,983 (+)MAPPERmRatBN7.2
Rnor_6.01675,594,973 - 75,595,106NCBIRnor6.0
Rnor_5.01675,195,671 - 75,195,804UniSTSRnor5.0
RGSC_v3.41675,400,760 - 75,400,894RGDRGSC3.4
RGSC_v3.41675,400,761 - 75,400,894UniSTSRGSC3.4
Celera1668,473,126 - 68,473,259UniSTS
RGSC_v3.11675,401,025 - 75,401,159RGD
RH 3.4 Map16694.4RGD
RH 3.4 Map16694.4UniSTS
RH 2.0 Map16801.6RGD
SHRSP x BN Map1638.59RGD
FHH x ACI Map1640.2499RGD
Cytogenetic Map16q12.4-q12.5UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
Genes:   Defb3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer ATGGTGCGCTGCTATGTCTA
Reverse Primer CAATACTGGATCTGGGGGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide JH618829.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)164445512389455123Rat
7411648Foco22Food consumption QTL 22150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)165942871491442908Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)longest distance run on treadmill (CMO:0001406)163439829479398294Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)163692878281928782Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)164445512389455123Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)164199206486992064Rat
8694364Abfw7Abdominal fat weight QTL 712.220.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)165942871491442908Rat
8694429Bw164Body weight QTL 16450.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)165942871491442908Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164909919691442908Rat
1298527Arunc2Aerobic running capacity QTL 22.9exercise endurance trait (VT:0002332)longest distance run on treadmill (CMO:0001406)167523528581732231Rat
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)163236104377361043Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 641623 UniSTS