D9Rat16 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D9Rat16

Symbol: D9Rat16
Previously known as: oxsts7501; R002-D12; R0002-D12; 
RGD ID: 34815
Expected Size: 179 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8968,875,497 - 68,875,676 (+)Marker Load Pipeline
mRatBN7.2961,381,434 - 61,381,613 (+)MAPPERmRatBN7.2
Rnor_6.0966,757,444 - 66,757,620NCBIRnor6.0
Rnor_5.0966,570,118 - 66,570,294UniSTSRnor5.0
RGSC_v3.4958,516,719 - 58,516,896RGDRGSC3.4
RGSC_v3.4958,516,720 - 58,516,896UniSTSRGSC3.4
Celera958,815,886 - 58,816,062UniSTS
RGSC_v3.1958,663,702 - 58,663,878RGD
RH 3.4 Map9495.2UniSTS
RH 3.4 Map9495.2RGD
RH 2.0 Map9574.9RGD
SHRSP x BN Map942.2298RGD
Cytogenetic Map9q31UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd
QTLs:   Bw14   Bp185   Tspe1  
Genes:   Fam117b  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GACAAGGGATGCCTTGAGG
Reverse Primer TCCCTACTGGTCTGCTCTCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307676Fam117bfamily with sequence similarity 117, member B96883433468902543Rat

Nucleotide Sequences
GenBank Nucleotide CH473965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000239 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2303170Bp332Blood pressure QTL 3323.730.027arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)9671488884474983Rat
631656Bp108Blood pressure QTL 1085.970.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)956047863101047863Rat
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)94002992585029925Rat
1582203Gluco19Glucose level QTL 193.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)963376862108376862Rat
1300180Bw14Body weight QTL 143.776body mass (VT:0001259)body weight (CMO:0000012)93125043268875676Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)94445825699506504Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)965657365108376720Rat
61450Ciaa3CIA Autoantibody QTL 36.5blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)92956766474567664Rat
1598834Memor11Memory QTL 112.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)94445825685262605Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92956766483835942Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)94172029586720295Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)964220169109220169Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)944458256121768150Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)964220169109220169Rat
1581580Uae34Urinary albumin excretion QTL 34urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)964220169109220169Rat
1581517Bp284Blood pressure QTL 284arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)93922018684220186Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)968875497121768150Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)948718864108376862Rat
7411656Foco26Food consumption QTL 269.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)94002992585029925Rat
1598849Memor17Memory QTL 172.2exploratory behavior trait (VT:0010471)difference between duration of physical contact or close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)95746049778547958Rat
1578659Tspe1Trichinella spiralis expulsion QTL 14.8parasite quantity (VT:0010441)logarithm of the intestinal adult Trichinella spiralis count (CMO:0002024)96887549773185088Rat
4889943Bss90Bone structure and strength QTL 904.1tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)95450650499506504Rat
1578757Pur6Proteinuria QTL 63.30.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)964220169109220169Rat
1641894Alcrsp12Alcohol response QTL 12response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)93496059079960590Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303340 UniSTS
  363236 UniSTS
  444933 UniSTS
  444979 UniSTS