D5Mgh8 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Mgh8

Symbol: D5Mgh8
Previously known as: oxsts5103; R5719; 
RGD ID: 34443
Expected Size: 141 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25143,069,996 - 143,070,159 (+)MAPPERmRatBN7.2
Rnor_6.05149,029,982 - 149,030,144NCBIRnor6.0
Rnor_5.05152,731,895 - 152,732,057UniSTSRnor5.0
RGSC_v3.45149,757,277 - 149,757,440RGDRGSC3.4
RGSC_v3.45149,757,278 - 149,757,440UniSTSRGSC3.4
Celera5141,531,866 - 141,532,028UniSTS
RGSC_v3.15149,767,317 - 149,767,479RGD
RH 3.4 Map5962.51RGD
RH 3.4 Map5962.51UniSTS
RH 2.0 Map5175.2RGD
Cytogenetic Map5 RGD
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs:   Scl2   Ciaa5   Bp103   Bp210   Rf32  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
7. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGAGCCCACCCAAAGAAATT
Reverse Primer CGTGTTATGTGTACATGTGCATG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473968 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000235 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326434 UniSTS
  326454 UniSTS
  369074 UniSTS
  544341 UniSTS
  544465 UniSTS